Skip to main content
Ir a la página de inicio de la Comisión Europea (se abrirá en una nueva ventana)
español es
CORDIS - Resultados de investigaciones de la UE
CORDIS
Contenido archivado el 2024-06-18

DEVELOPMENT OF DIAMOND INTRACELLULAR NANOPROBES FOR ONCOGEN TRANSFORMATION DYNAMICS MONITORING IN LIVING CELLS

Final Report Summary - DINAMO (DEVELOPMENT OF DIAMOND INTRACELLULAR NANOPROBES FOR ONCOGEN TRANSFORMATION DYNAMICS MONITORING IN LIVING CELLS)

Executive Summary:
4.1.1 Executive Summary
DEVELOPMENT OF DIAMOND INTRACELLULAR NANOPROBES FOR ONCOGEN TRANSFORMATION DYNAMICS MONITORING IN LIVING CELLS
FP7-KBBE KBBE-2009-3-6-01, Contract No: 245122
Project website address: http://www.fp7-dinamo.eu(se abrirá en una nueva ventana)

The DINAMO project has explored the potential of synthetic fluorescent nanodiamond particles (fND) as a nanoscopic tool for real-time monitoring in living cells. Figure 1 shows the incorporation of fND, carrying peptide on its surface, directed to the cancer cells. Technology for production of fNDs in the form of nanoscopic fractions of synthetic diamond crystals of controllable sizes was developed. Artificial colour centres containing nitrogen atoms and carbon vacancy (NV centre) point-defects were engineered into nanodiamond. The NV centre producing single photon fluorescence and single spin magnetic signals were employed in ultrasensitive optical sensing and magnetic resonance imaging (MRI) at the nanoscale. Nanodiamond fluorescence was found to be stable and unblinking, unlike fluorescence dyes or quantum dots. The highly biocompatible and chemically resilient diamond surface allowed bonding of molecular probes. Biomolecular detection principles were developed for applications in cell-biology. fND devices were applied to cancer cells or cancer-bearing animal models, demonstrating this novel tool for theranostic applications.

DINAMO project has developed the following platforms:
1. Production routes for fluorescent nanodiamond particles, engineered from commercially available nitrogen – containing synthetic diamond, were established. High energy particle irradiation was used to produce carbon vacancies by a controllable rate and forming NV centres by interacting with nitrogen. Reproducibility and reliability of the technology was tested and processes that can be used in mass production were evaluated.
2. fND surface modification by functional groups including fluorine and complex click chemistry grafting strategies were applied to fND colloids, allowing attachment of identified targeting or sensing molecules to fNDs..
3. fND photonic mapping, scanning magnetometry, fND - FRET sensing and fND - MRI with chemicaly grafted Gd and Eu, were developed as novel detection platforms for nanoscopic in vitro monitoring.
4. Application of NDPs to cell biology and nanomedicine by assessing NDP cytotoxicity, inflammatory reactions and fND potential for biological monitoring in vivo and in vitro was carried out. fNDs were extremely well tolerated when administrated to mice models and were applied for targeting, DNA delivery and monitoring of oncogenic transformation in different type of cancer cells.

DINAMO achievements were disseminated via press releases, newspaper articles, internet channels and high impact publications and triggered excessive interest of the biotechnological, medical and material science community. DINAMO has produced durable bonds between partners from the EU, US and Australia that can be further pursued for applications on biotechnology.
(see FIgure 1 in the attachment)
Project Context and Objectives:
4.1.2 A summary description of project context and objectives

DEVELOPMENT OF DIAMOND INTRACELLULAR NANOPROBES FOR ONCOGEN TRANSFORMATION DYNAMICS MONITORING IN LIVING CELLS

FP7-KBBE KBBE-2009-3-6-01, Contract No: 245122
Project Coordinator: Prof. M. Nesladek, IMEC, Belgium
Project website address: http://www.fp7-dinamo.eu(se abrirá en una nueva ventana)
(Full version with Figures, please see attachment)

Project context
Real time monitoring of biomolecular processes in living cells is a topic with high application potential for biotechnology, cell-biology, nanomedicine and neurosciences. Progress in nanotechnology fabrication has led to the development of lab-on chip devices that allow for bioanalyte screening; however, nano-tools for long term contactless monitoring of intra-cellular processes in vitro and in vivo with ultra-high resolution are yet to be developed. The current in- vitro techniques rely mainly on a group of confocal microscopy techniques employing fluorescent dyes. These techniques have limited lifetime and bleach, or employ quantum dots, which are mostly toxic and requiring biocompatible coatings for in vitro or in vivo usage. MRI and PET techniques allow monitoring of on-going processes in biological environments, however, the spatial resolution is limited and these techniques require contrast, which is often done with radioactive agents.

Figure 1. Super-resolution NV microscopy , , (fND scheme with the NV colour centre is depicted on the left) using optically detected wide-field magnetometry, allowing topically detected MRI mapping such as Gd3 þ ions (right: a,b). Widefield excitation (green laser) of the NV spin array (red arrows) is combined with spatially resolved CCD detection of NV fluorescence. (c) Energy level scheme of NV centre illustrating the fluorescent signal extending from 637–800 nm. (d) Bright field image of the microfluidic channel

Project goals:
In the context of research development in the field of nanobiotechnology, strategies for real time detection are being developed. DINAMO aimed at development of a brand new branch of super-resolution nanoscopic techniques that can allow monitoring of bimolecular processes in living cells in the real time. These techniques rely on unique optical and magnetic properties of Nitrogen Vacancy centres in synthetic diamond nanocrystals and nanoparticles (fNDs, see Fig. 1) as a nanoscopic tool that can be applied for in vitro and in vivo contactless imaging .

Figure 2. Confocal optical image of MCF7 HER2 high expressing human breast cancer cell line, decorated by monoclonal antibodies (left), MCF7 cell incubated with HER2 grafted fND particle middle) and composed image confirming co-localisation of fND close to the cell membrane targeting the cell receptors (right, note the colour change of the fND by overlapping red and green colour leading to yellow and confirming co-localisation).

fNDs were engineered as 5 – 100 nm sized fractions of perfect diamond crystals with carbon in sp3 bonding state. In fNDs an artificial point-defect centrum can be generated containing nitrogen atom and carbon vacancy, so called the NV centre. The NV centre can produce single photon luminesce and single spin magnetic resonance signals that can be further employed for nanoscale ultrasensitive sensing and imaging (see Fig.1). Diamond luminescence is stable, unlike quantum dots and diamond surfaces are highly biocompatible, chemically stable and allowing covalent and ionic binding of biomolecules. These properties made fNDs suitable to be used for biological monitoring in real time in cells. Important additional value of fNDs is the ability to target the fNDs to specific cells or even intracellular locations and to use them fort optical and magnetic imaging. When used in conjugation with therapeutic molecules, attached to fND surface, it can combined into devices exploited for theranostic, i.e. therapeutic applications performing diagnoses and conjugating monitoring of disease progression and treatment. A large number of fND applications can be envisaged.

Project objectives
One of main objective of the DINAMO project was to develop fND particles that can be applied for real-time monitoring including super resolution microscopy and, as an impacting demonstration to apply it for monitoring cancer cell systems. DINAMO goal was to combine fND targeted delivery with imaging capabilities onto one device. This visionary idea was explored systematically, starting rom fND engineering to the final nanoscopic imaging in cells.

The DINAMO had following objectives:

• Establishment of reliable production of fluorescent nanodiamond (fND) particles from commercially available nitrogen–containing synthetic diamond by high energy particle irradiation, in order to achieve the highest possible NV conversion efficiency and consequently bright luminescence suitable for commercial confocal imaging.

• Preparation of fND of controlled sizes, in order to optimise the fND uptake, luminescence and their single spin imaging capabilities.

• Modification of the fND surface by functional groups to control luminescence charge transfer which can be used for biomolecular detection. Surface functional modification was also important for grafting scheme strategies ,

• Development of grafting strategies such as click chemistry, allowing attachment of targeting or sensing functions of fNDs

• Exploring nanoscopic photonic (FRET, Charge luminescence switching) and magnetic resonance (NV-ODMR, MRI, single spin magnetometry) imaging principles to allow high resolution and enable imaging capabilities below the diffraction limit of the light, targeting 10 nm resolution.

• Assessing fND cytotoxicity and inflammatory reactions to confirm that fND can operate in cells for a prolonged period of time, without influencing the cell metabolism or evoking any adverse inflammatory or toxic response.

• Investigating the potential for biological monitoring in vivo and in vitro. Final challenging task was application of for application of the developed nanoscopic tools for monitoring of oncogenic transformation in different type of cancer cells and for their treatment.

Reliability and industrial applications
While developing novel fluorescent diamond nanoparticles (fNDs) for imaging techniques, DINAMO project carefully addressed the suitability of selected technologies for future industrial exploitations. DINAMO used materials and technologies that are scalable and can be used for mass production in the future. Systematic optimisation of fND luminescence allowed a feedback to fabrication methods, which have been optimised. Depending on the purpose of the fND used, DINAMO identified the NV synthesis parameter regions, including: optimal high energy particle irradiation strategies, temperature of annealing, chemical cleaning processing and functionalization to produce nanodiamond particles with defined sizes, defined number of NV centres, high luminescence yield, and specific functional termination allowing for development of bio-molecular probes.

Figure 3 fND Raman spectra: influence of thesurface termination and surface treatment after irradiation and annealing during the fabrication of fNDs with high proportion of NV- /NV0 centers (a). The normalized relative photoluminescence of NV—-centers at various temperatures and times of annealing(b). Available size of fND ranges from several to 100 nanometers. Even small size fND can be engineered from HPHT diamond(c).

The potential impact
Development of DINAMO targeted several potential impact areas:
• To establish the DINAMO consortium as a leading interdisciplinary team in the world, developing super-resolution luminescence and spin based magnetometer microscopy, applicable for biological imaging at nanoscale.
• Development of fND particles as fluorescent biomarkers for in vitro and in vivo applications in life sciences and for further industrial applications.
• Development of MRI imaging in cells combined with fluorescence microscopy and other novel biomolecular sensing principles.
• Development of biocompatible nanoscale sensors that can be applied for intracellular detection with potential in nanomedicine, nanobiotechnology and related application areas, based on charge sensing and on fluorescence detection and development of a platform for targeted drug delivery.
• Disseminating the knowledge developed by targeting the scientific community by publications in cross disciplinary biological and medical sciences, organizing seminars and presenting the work in scientific and popular workshops, press releases, and newspaper communications.
• Collaborating with SMEs on the development fND platform and detection techniques, as well as on identification of possible applications.
• To promote international collaboration with leading groups in the field in the US and Australia, and to benchmark the research with other groups in Europe and Asia.
• To promote exchange of MSc and PhD students between US and Asia and to interface to other running national, EU and US projects.

Project Results:
4.1.3. Description of the main S&T results/foregrounds
Upon its start in 2009, the DINAMO project set its main scientific goal to develop high resolution fluorescent and magnetic resonance imaging and sensing in living cells, as a first project of its kind. The DINAMO project identified potential of fluorescent nanodiamond particles (fNDs) for applications in bionanotechnology and nanomedicine. The final target of DINAMO was to demonstrate novel tools for cancer research diagnostic and monitoring.

The DINAMO project addressed following research:
• Fluorescent diamond nanoparticle engineering
• Grafting strategies and assembly of bioactive molecules
• Novel super resolution cell-sensing methods
• Cellular imaging of fNDs and monitoring of oncogenic process

4.1.3.1 Fluorescent diamond nanoparticle engineering (WP1)
The main aim objective of this activity was to develop fluorescent nanodiamond particles, Specifically:
• Optimization of the production of nanodiamond particles (NDP) from different diamond sources, i.e. HPHT diamond, detonation diamond and CVD diamond
• Optimization of fND surface termination by different methods, depending on the starting synthetic diamond material.
• Improving the protocols for the production of stable colloidal solutions of the above mentioned diamond nanoparticles and to deliver such material for further grafting and testing.
• Investigation of the generated defect centres for an optimal control of the label properties.
• Production of fluorescent nanodiamond with multivalent surface, especially with orthogonal surface groups for the independent grafting of different bioactive moieties.


Fig. 4.1.3.1.1: Schematic presentation of process steps for the production of luminescent and multivalent diamond nanoparticles (NDP).

4.1.3.1.1 NDP fabrication
DINAMO consortium worked on several approaches for the production of nanodiamond particles of various sizes to address all requirements for cell imaging. While in the first part of the project we have mainly worked on optimisation of HTHP (high pressure high temperature) diamond particles, in the second half of the project also other types of synthetic diamond were studied (CVD - chemical vapour deposition and DND- detonation nanodiamond). DINAMO further optimized the milling process for the deagglomeration and stabilization of hydrophilic and functionalized nanodiamond particles depending on tis origin and is now able to produce such material in large quantities as a stable colloidal solution with high purity. For super resolution imaging, a single NV centre per each nanoparticle is preferred, while for biological applications very bright luminescent nanodiamonds with highest possible NV centres are needed. DINAMO optimized the process of formation of NV centres in order to get nanodiamonds with the controlled number of NV centres per particle as well as control defect state occupation.


HPHT diamond
Fig 4.1.3.1.2: Normalized luminescence intensity for different types of high energy particle irradiation treatment. The right size of the figure shows the map of numbers of NV centres formed per particle with maximum formation efficiency at about 900 oC.

DINAMO studied strategies for high-energy irradiation of type Ib nanodiamonds (most commonly HPHT) as the most favorable method for the large scale production of highly luminescent nanodiamonds. HPHT nanodiamond particles are commercially available at low cost in the size ranging from ~ 30 nm to hundreds of nanometers. Another advantage is the natural abundance of N centers (isolated substitutional nitrogen in the diamond lattice) which can be used for NV formation. Figure 4.1.3.1.2 shows normalized luminescence intensity from high-energy irradiation experiments.

Accelerators, i.e. isochronous cyclotron U-120M and microtron MT 25, were used for the production of the fluorescent nanodiamond (fNDs). The irradiations were performed both on cyclotron beams (p+, d+, 3He2+, 4He2) with energies from 5MeV to 25MeV and microtron with electron beams of energy range from 7MeV to 23MeV. Particle density was chosen to be approx. 1016/cm2. Target holders were designed for the purpose of irradiation in cyclotron, the electron irradiation was performed using glass vial as the target.. Two different irradiation energies were chosen for each type of irradiation particles in cyclotron (p+, d+, 3He2+, 4He2); energy deposit with Bragg peak (ion beam is stopped in the target) and without Bragg peak (ion beam flies through the target). Two size ranges of nanodiamonds were used: ND with the size distribution at 35 and 130 nm. By using centrifugation, we could separate from the irradiated and treated fNDs categories sizes from about 8 nm till 150 nm as determined by dynamic light scattering ( DLS) or TEM. All particles were subsequently annealed at 700 °C for 2 hours under the Ar atmosphere and oxidized by wet oxidation. To analyze the quality of samples, all samples were characterized by fluorescence, single NV centre imaging and Raman spectroscopy.

For 35 nm ~10% efficiency of NV creating (i.e about 5.6 NV centres/particle) has been reached at the and of the project . The development of very small fND would give real chances for commercialization of ultra small highly luminescent diamond for biological probes where small size is important. And also Si-V ND which just recently appeared in the literature were synthetized.


Fig. 4.1.3.1.3: Luminescence intensity of variously terminated NDs as a function of size. The Fluor/Ox represents nanodiamonds that were fluorinated after oxidization, leading to partially oxidized/partially fluorinated surface. The Fluor/Hydro represents NDs with fuoro-hydrogenated surfaces. a) The peak intensity of the NV- and NV0 zero phonon line; b) the corresponding photoluminescence spectra .

DETONATION NANODIAMOND
Commercial detonation nanodiamond, produced by mass fabrication, contains nitrogen in high amounts and from this material bright fND could be theoretically produced. DINAMO has planned to use DND but it was found that in DND NV luminescence is quenched due to its high defect density, the presence of non diamond carbon and fact that most of the nitrogen is not incorporated in NV configuration. DINAMO, jointly with National Institute for Materials Science in Tuskuba in Japan, have applied high-pressure high temperature sintering process to activate nitrogen defects in the detonation crystallites (as they are typically not found on lattice positions after the production) and to improve the overall crystal quality of the material. DND pellets were highly sintered and isolation of the primary particles proved to be difficult. However, DINAMO consortium managed to mill this material into nanoparticles with very small diameter (~15 nm) proved the luminescence of the resulting nanomaterial has been enabled. This is a major achievement and novelty as this process will provide luminescent and very small fNDs without the need of costly irradiation and without the risk of lattice damage due to the electron or proton beam. This demonstration of principle enables to use DND for luminescent microscopy, however purification methods of such particles have still to be optimised.

a)
b)
Fig. 4.1.3.1.4: particle size distribution (a) and Raman spectrum (b) of sintered detonation nanodiamond after crushing of the sintered pellets.

DND nanodiamonds have been investigated after sintering and milling. Starting point of the investigations was that the sintered crystals showed very strong NV luminescence with even a partial alignment of the defects. When those sintered DND are milled again a rather heterogeneous scenario results. For certain DND bright NV luminescence is found while in most cases an unspecific luminescence, i.e. non-NV fluorescence is found. For the moment the origin of which is not clear. However, as main result, by this way very small nanoparticels can be produced with extremely high luminescence. In some case the luminescence counts/NP exceeded 10 x the optimised HPHT diamond, that would indicate about 50 NVs or more per one nanoparticle.

CVD diamond films
DINAMO worked on the optimization of the production of nanodiamond particles from CVD films. The milling beads, using zirconia metal beads, was optimized and the complete removal of any contamination was achieved after the milling. This step was essential for preparation of stable colloids. Subsequent purification of the colloid using different mineral acids, in some cases followed by air oxidation to control the surface termination. The removal of sp2 carbon was closely followed by Raman microscopy. It was shown that with a multi-step etching and oxidation process the Raman signal of graphitic material disappears and the quality of the resulting diamond nanoparticles is significantly improved.


Fig. 4.1.3.1.5: Size distribution before (a) and after (b) BASD treatment of pre-milled CVD film (left) and TEM image of milled diamond particles from CVD film (right

The particle production pathways from CVD diamond were established by this way, relaying on luminescence from in situ doping by nitrogen or silicon (Si-V centre, see Fig. 4.1.3.1.5b)

4.3.1.1.2 Surface engineering and functionalization
DINAMO has developed the surface modification of fND aiming at stable colloids, stable luminescence and also control of surface potential band bending, that is important for development of nanoscale probes (charge interaction effects). In order to improve the control over surface termination, DINAMO has developed new protocols for the homogeneous termination of ND with reactive surface groups that allow the convenient grafting of the bioactive moieties in WP2. These are the following reactions (all shown in Fig. 4.1.3.1.6).

Control of the initial surface termination by formation of C-C bonds
a)Bingel-Hirsch reaction
Binge- Hirch moditication of fND was developed as a versatile tool for the homogeneous termination of fND surfaces. This approach allowed the process for different malonates tused as starting points for the grafting of larger moieties and allowed the orthogonal functionalization.

b) Prato reaction
Prato transformation based on azomethine ylide reaction with a -bonds to yield a pyrrolidine systems. This strategy enabled not only the orthogonal functionalization, but also the stoichiometric control on annealed nanodiamond allowing to homogenize the surface while.

c) Grafting of benzoquinone
DINAMO has established a protocol for the immobilization of proteins on benzoquinone functionalized nanodiamond using buffer solution as the solvent and addressing the reactive sites stepwise by changing the buffer pH in a controlled fashion. With this method it is possible to graft aminated molecules (like the N-terminus of a protein or the amino group in lysine side chains) with high efficiency and without any side product or additional reagent. This method is therefore highly recommended for NDPs that are supposed to enter a living system.

a)

b)

c)

Fig. 4.3.1.1.6: Newly developed reactions for the homogenization of nanodiamond prior to the binding of larger functional moieties. a) addition of malonates to surface sp2 carbon by the Bingel-Hirsch reaction; b) pyrrolidine formation using the Prato reaction of isochinolinium salts; c) grafting of benzoquinone moieties onto hydroxylated nanodiamond and their use for the immobilization of proteins

d) F-terminated fND

This novel termination of fND was developed by DINAMO project. C-F bond - very stable and strongly polarized. Fluorine can modulate:
• Occupation of NV0/NV – centres.
• The rate of non-radiative electron transitions.
• Increase colloidal stability improve biocompatibility.
• Affecting the relaxation time τ2 of NV electron spins.

Besides the possible impact of fluorination on the luminescence properties, fluorinated nanodiamonds could be also used as a probe for NMR imaging. Another application is a use of fluorinated ND in the development of highly hydrophobic ND that are required in specific drug delivery systems. Although there are specific plasma techniques of fluorination, these techniques were mainly applied to flat CVD diamond plates. To achieve high surface coverage also on HPHT NDs, original method was developed, based on the reaction with gaseous fluorine in the presence of hydrogen was modified to the reaction process with the gaseous fluorine in liquid hydrogen fluoride at elevated temperatures.

Fig. 4.1.3.1.7: Comparison of intensity form 35 nm fND terminated by oxygen groups, hydrogenated surfaces and novel developed fluorine termination. The right part of figure shows enhanced occupation of NV- centres. The bottom picture shows the principle of changing occupation of NV- and NVo centres by surface band bending and corresponding luminescence shift.

f) Establishment of surface groups for the grafting of more complex moieties
In order to enable the grafting of functional molecules in WP2 , DINAMO developed strategies for the establishment of suitable surface groups. In most cases we used the initial surface homogenization reaction directly to bind carboxylic acids, azides, alkynes, amines etc. onto the NDPs. Besides the reactions discussed above (Prato, Bingel-Hirsch, benzoquinone) the previously reported arylation using diazonium salts was further optimized and yielded several functionalized ND derivatives with one or more grafting moiety. fND carrying aromatic moieties with azido ethyl residues in para position to the binding site have been delivered for the exploration of triazol ligation using click chemistry. TYhe protocol for the click reaction between the azide and the alkyne on the functional moiety has been used ,

g) New approaches- stiff linkers. These were undertaken to engineer longer, stiff linkers for the immobilization of sensitive biomolecules and developed by the DINAMO consortium. These strategies were conceived based on a tolane based linker system that can be used to elongate the binding site from the NDP surface and at the same time increase the space between these binding sites.

h) fND samples carrying benzoic acid and azide moieties were developed, allowing independent immobilization of two different moieties, one by conventional peptide ligation, and the other by azide-alkyne click chemistry, qualifying for orthogonally functionalizion of fNDs. The protocol for the clicking to the azide moieties was then used in DINAMO for the successful grafting of targeting moieties and therapeutic moieties (see WP2 for details).

4.1.3.3 Optical and magnetic centre engineering
A detailed study to control over the fND luminescence and spin properties has been executed by DINAMO consortium. DINAMO has investigated the influence of the surface oxidation state, fluorination on the charge state of the NV centre . The NV charge switching (see Fig. 4.1.3.1.3) was employed by the DINAMO consortium as an important tool for biomolecular probes. Upon the interaction of NV centre laying close to the fND surface with biomolecule charges in the close proximity the luminescence wavelength can change by altering the zero phonon line transitions ( ZPL) belonging to NV- or NV0 charge states.
Fig. 4.1.3.1.8: Spin relaxation measurements in oxidized and F-terminated fND. The right image shows engineered Si-V centers in CVD and high-resolution luminescence mapping.
SiV and other defects were discovered by DINAMO consortium, with outstanding emission and even spin properties. A new defect was found in nanostructured diamond material. It has been characterized in great detail and was found to be an electron spin singlet state. It is of similar brightness than the NV centre but the modulation of fluorescence intensity due to resonant microwave transition is a factor of 3 higher giving superior electron spin resonance signatures. Very strong ODMR signals are found with fine structure parameters of D=1200MHz and E=30MHz. The Stuttgart group succeeded in observing nuclear rabi oscillations which make the defect an interesting spin probe (see Fig. 4.1.3.1.9).

Fig. 4.1.3.3.9: Proposed structure of the defect. The orientation of the defect is along 100 and its symmetry is C2v. b) Nuclear Rabi oscillations in the ground state of the defect.

By analyzing the photophysical cycle of the color center it turns out that it has a metastable electron spin triplet state and singlet ground states. The lifetime of the triplets states is on the order of 0.1 to 1 ms. Dynamic nuclear spin polarization in the triplet state has been achieved by choosing a resulting magnetic field at electron spin level anticrossing. The resulting nuclear spin polarization can be detected in the excited state but also in the ground electro spin less state. The defect thus allows NMR detection in its ground state without the perturbing presence of the electron spin, a great advantage compared to the NV center

4.1.3.2 Grafting and assembly of bioactive molecules (WP2)
The aim of this work package was chemoselective grafting and assembly of different biologically active molecules onto the surface of luminescent HPHT NDs. The fulfilment of this goal required at first a pioneering work in the field of surface chemistry of HPHT NDs, for which, in contrast to the detonation NDs, little is known. HPHT NDs, in comparison with detonation NDs, have different surface bonding architecture and hence different reactivity. This enabled us to functionalize luminescent HPHT NDs with chemical functions/anchors tailor-made for employing common ligation techniques. At the same time, properly modified biomolecules (peptides, oligonucleotides and saccharides) were synthesized and successfully grafted onto ND surface. These results proven that luminescent HPHT NDs are very promising platform for construction of new intracellular biosensors and delivery systems.

4.1.3.2.1 Chemoselective grafting of bioactive molecules
This task comprised two particular tasks, i.e. modification of ND particles by chemically distinct functions/anchors and chemoselective grafting of bioactive molecules.

Fig. 4.1.3.2.1: Reduction of fNDs with complex hydrides and FTIR spectra

In the case of modification of NDs by chemically distinct functions/anchors we focused our attention on O-alkylation of hydroxyl-terminated NDs and on nucleophile substitution of bromine of brominated NDs with precursors of anchors for grafting bioactive molecules and their subsequent transformation to these anchors. DINAMO has carried out aromatic arylation of NDs having sp2 hybridization with diazonium salts generated in situ from aromatic amines presenting functions suited for grafting biomolecules.

Preparation of hydroxyl-terminated NDs with high density of coverage
In order to get highly monofunctionalized HPHT NDs DINAMO has investigated the reduction protocols used in the case of detonation NDs. Various reducing agents and distinct reaction conditions were examined and the best result was obtained by using of LiAlH4 at 120 °C. FTIR data of NDs after reduction showed lower intensity of carbonyl stretch band.

O-Alkylation of hydroxyl-terminated NDs with precursors of anchors for grafting bioactive molecules and their subsequent transformation to these anchors.

Fig. 4.1.3.2.2: O-Alkylation with OH- terminated NDs with ethyl bromoacetate and bromoacetonitrile and corresponding FTIR spectra.

Alkylation agents of this type ethyl and t-butyl bromoacetate and bromoacetonitrile were selected, because these functionalities can be subsequently easily converted into anchors enabling employment of common ligation techniques (Fig. 4.1.3.2.2). Optimization of alkylation revealed that the best conditions for alkylation are either NaH in DMF at 60 °C or Cs2CO3 in DMSO with catalytic amount of 18-crown-6 ether at the same temperature (Fig. 4.1.3.2.2). The functionalization with ethoxycarbonylmethyl group clearly indicates the presence C-H stretch at ~2900 cm-1 and CH3 and CH2 bending bands at 1450 and 1378 cm-1 of ethyl moiety. The introduction of cyanomethyl group documents C-H stretch at ~2900 cm-1 and nitrile stretch band at 2200 cm-1.
The ester group was subsequently converted by reaction with hydrazine to give acylhydrazide function. FTIR data showed significantly lower intensity of ethyl ester stretch band at 1740 cm-1 and acylhydrazide stretch band at 1710-1650 cm-1. Nitrile group was reduced with LiAlH4 to amino group, which documents the decline of intensity of nitrile stretch band at 2206 cm-1.

Fig.4.1.3.2.3: Transformation of ester to acylhydrazide of nitrile group to amine group and corresponding FTIR spectra

The prepared NDs surface modified with anchors presenting amino or acylhydrazide group can be directly employed for grafting biomolecules by using of amide, acylhydrazide and square acid ligation techniques or to transform to other anchors, e.g. anchors presenting aminooxy group which enables to graft biomolecules using oxime ligation. The loading in both cases was relatively low (0.06 mmol/1g).

Functionalization NDs via sp2 hybridization
Temperature-controlled annealing gives NDs with sp2 hybridization, i.e. having surface modified with C=C double bonds. The presence of double C=C bond opens the way for broad spectrum of subsequent chemical transformations. We successfully applied radical aromatic arylation of the annealed NDs introduction of amino group by reaction with diazonium salt generated in situ from aromatic amine carrying aminoethyl group. The achieved loading was in this case relatively high, i.e. 0.2 mmol/1 g.

Fig. 4.1.3.2.4 Preparation of amino and azido functionalized NDs via sp2 hybridization


For the introduction of azide group directly onto ND surface the synthetic scheme based on brominating of the annealed NDs with bromine and subsequent nucleophile of bromine with sodium azide was used. The presence of an azide group was confirmed by FTIR spectrum (2112 cm-1). Also in this case the relatively high loading was obtained (0.12 mmo/1g). Azide group enable to graft biomolecules directly onto ND surface by click-chemistry or can be reduced to amino group. For the determination of loading, the original approach based on the Fmoc-release used in peptide chemistry was elaborated. The prepared NDs are for this purpose modified with properly functionalized Fmoc-amino acids, i.e. Fmoc-glycine, Fmoc-propinylglycine and alfa-Fmoc-azidolysine.

Construction tumor nanoprobes based on covalently grafted biomolecular vectors with high affinity to the tumor markers overexpressed on the surface of malignant cells
In this particular task we focused onto peptide vectors having high affinity to the receptors and tumor markers, i.e. analog of the somatic hormone bombesin with high affinity to receptors overexpressed in many human gastrointestinal cancers, heptapeptide with affinity to HER2 tumor marker overexpressed on the surface of breast cancer cells and alfa-MSH peptide with high affinity to melanomas. For the grafting peptide vectors onto ND surface the click-chemistry was successfully employed. The starting NDs presenting simultaneously triple bond and carboxyl group were prepared. The fact that these probes possessed very low stability of their colloids in aqueous and biological milieus led to idea to improve the colloidal stability by introduction of hydrophilic glucamine. The prepared probes were characterized by MS spectrometry, IR spectroscopy, amino acid and elemental analysis. Bio-imaging in cancer cells used fND with this chemical grafting.
Fig. 4.1.3.2.5 Tumor nanoprobes based on covalently bonded peptide vectors and their preparation

The fact that metastatic and cancer stem cells, which are responsible for new tumor grove after therapeutic impact, are characterized by overexpression of tumor-specific marker CD44 having a high affinity to hyaluronic acid (HA) fragments, motivated us to prepare nanoprobes based on covalently grafted HA fragments. These fragments were regioselectively conjugated via reducing with amino terminated NDs by reductive amination. After the grafting HA fragments the positive zeta potential abruptly changed to negative values. The covalent attachment of HA onto NDs was proven by washing with citric acid because in comparison with electrostatically attached HA remained the same. The prepared probe was characterized by MS spectrometry and FTIR spectroscopy. The NDs grafted covalently and non-covalently with nucleic acids are reported in the following tasks

Fig. 4.1.3.2.6: Tumor nanoprobes targeted with hyaluronic acid

4.1.3.2.2 Development of nucleic acids hybridization
Main goal of this task is construction of nucleic acid probe based on fluorescent NDs covalently grafted with nucleic acid. The process of nucleic acids hybridization is connected with charge transfer and this effect results in changes of the NV0/NV- photo luminescence proportion. Such nanoprobes should allow monitoring of the dynamics of hybridization process in cells (Fig. 4.1.3.2.7 ).

Fig. 4.1.3.2.7: Schematic procedure of nucleic acid hybridization probe

For the grafting of oligonucleotide onto FNDs the click-chemistry ligation technique was used (Fig. 4.1.3.2.7). The florescent NDs presenting azido groups were prepared in the frame WP1 The appropriate oligonucleotides were prepared by GENERI. For this purpose were synthesized 32-mer 5`-hexynyl, 3`-BH GTTAGCACGATAGTCCGATAGTCAGTCAGTCC and complementary 32-mer 5`- 6-FAM GGACTGACTGACTATCGGACTATCGTGCTAAC. This fluorescent molecule has excitation/emission characteristics different than the FNDs and should be quenched by a quencher molecule. This system enables controlling the effectiveness of DNA oligonucleotide modification of NDs and parallel monitoring of the hybridization process. Pilot hybridization experiment in water confirmed our preposition about changes of photoluminescence characteristic.

Multi-modal MRI probes for in vivo application
For the construction of multi-modal MRI probes based on fluorescent NDs we preferentially focused on systems with covalently grafted with metallochelating centers center for Gd(III) and Eu (III). Instead of DOTA ligand (carboxymethyl derivative of aza-crown-4) its phosphonate analog developed with by colleagues from Faculty of Science, Charles University in Prague was used. The introducing of the negatively charged phosphonate function in the neighborhood of the Gd(III) enhance the water exchange rate. For covalent grafting metallochelating center for Gd(III) or Eu(III) the approach based on aromatic arylation of NDs having sp2 hybridization with diazonium salts generated in situ from aromatic amines presenting Gd(III) or Eu(III) complex was successfully employed (Fig. 4.1.3.2.8). The surface modification was confirmed by elemental analysis (pristine NDs: C 95.57%, H 0.41%, N; Gd-DOTA modified NDs: C 81.57%, H 1.05%, N 2.00%; Eu-DOTA modified NDs: C 74.56%, H 1,05%, N 1.37% ), ICP-OES analysis (Gd-DOTA modified NDs: Gd 2.08%; Eu-DOTA modified NDs: Gd 1.70%) and by FTIR spectra. The proportion of gadolinium or europium and nitrogen after the grafting onto NDs more or less responded their proportion in the used phosphonate metallochelates. NDs with covalently attached gadolinium or europium probe form stabile colloids in water having relatively monomodal size distribution, which is a promising result for their application in vivo.

Fig. 4.1.3.2.8: Fluorescent and MRI probes for in vivo applications

Transfecting systems
The presented transfection system represents new principle for optical monitoring of gene delivery based on presumption that alternation of differently charged analytes - positively charged PEI and negatively charged nucleic acid (NA) evoked changes of the NV0/NV- photo luminescence proportion. The noncovalent grafting, based on electrostatic should allow the controlled release of the NA cargo from the ND-device into intracellular space. The appropriate experiments performed in cell medium confirmed this assumption. The presence of positively charged PEI led to decreasing or quenching of NV- photoluminescence. Subsequent addition of negatively charged NA (oligonucleotide on GFFP plasmid) let to the fact that the positive charge is compensating in restoration of NV- luminescence (see Fig. 4.1.3.2.9). Carboxylated NDs form with PEI stable colloidal complex and the final transfection construct is relatively stable in plasma. Biological experiments in vitro shoved, that thin firmly PEI is less nontoxic in comparison with PEI alone and PEI-fND is able effectively transfected targeted cells.
Fig. 4.1.3.2.9: New principle for optical monitoring gene delivery

4.1.3.3 Novel super resolution cell-sensing methods (WP3)
DINAMO has laid bases for novel super-resolution techniques used as real time nanoscopy techniques that can be applied for in-vitro monitoring of nanoscale. These techniques can be applied to various applications ranging from living cells to tissues or body liquids. In particular DINAMO has developed following nanoscale imaging techniques:
1. Nanoscale optical charge imaging
2. MRI imaging and nanoscale magnetometetry
3. Diamond Foerster Resonance Energy Transfer (FRET) technique

4.1.3.3.1 Nanoscale optical charge imaging
DINAMO project has developed novel type of detection method based on the charge transfer between different charged states of NV centres co called NV- and NV0 charge states, that lead to luminescence wavelength shift The NV-/NV0 luminescence switching id based on the surface potential band/bending, driving the occupation of these two charge states. The effect has been calculated theoretically and also proven by a patterned deposition of hydrogen and oxygen of diamond surfaces that have different surface potential. We demonstrated that the charge state can be controlled by an electrolytic gate electrode . This way, single centres can be switched from an unknown non-fluorescent state into the neutral charge state NV0, and the population of an ensemble of centres can be shifted from NV0 to NV −.

Fig. 4.1.3.3.1: Electrical manipulation of the charge state of NV centres in diamond. (a) Sketch of the experimental configuration showing the shallow-implanted NV centres in the O/H-patterned diamond surface. (b) Energy band schematic of the diamond/electrolyte interface and charge transition levels NV + /0 and NV0/ − . (c) Fluorescence image of an O/H-patterned diamond with shallow-implanted NV centres under floating gate conditions. Regions 1 and 2 indicate areas with low and high dose of NVs, respectively. (d) Time trace of the fluorescence intensity upon changes between UG = ± 0.5 V (650 nm longpass filter) recorded on region (2).
Numerical simulations confirm the manipulation of the charge state to be induced by the gate-controlled shift of the Fermi level at the diamond surface. This result opens the way to a dynamic control of transitions between charge states and to explore hitherto inaccessible states, such as NV + .These findings offer a first way to reversibly control the charge state of the NV centres in an extremely versatile manner, providing an important tool for the use of single NV centres for diamond-based spintronics or sensing applications. A short time ago we successfully transferred the manipulation of the NV charge state to single fluorescent nanodiamonds. This was mediated by charged polymers adsorbed to the surface of the fluorescent nanodiamonds. Figure 4.1.3.3.2 shows the spectra of a fluorescent ND containing a single emitter with and without the presence of a positive charged polymer (polyethyleneimine/PEI800).

Fig. 4.1.3.3.2: Photoluminescence spectra of a fluorescent nanodiamond (fND): After coating the nanodiamond with the positive charged polymer polyethylenimine (PEI800) the embedded nitrogen vacancy change its charge state from the negative to neutral one.
Due to the polyethylenimine a discharging from NV- to NV0 is visible. It is known that this polymer does also increase the uptake of DNA into cells. The resulting transport system made out of fluorescent nanodiamonds coated with PEI and loaded with DNA offers the opportunity to monitor the binding, transport and successful release of DNA for transcription inside living cells under ambient conditions.

The results led to several invited presentations from partners described in dissemination section. In cased of fND, The charge transfer was induced not only by hydrogenation or oxidation but also fluorination. It was found that the NV-/NV0 ratio depends on the functional groups at the surface and can be enhanced tuned by the presence of F- surface groups.The principles of charge-interaction of molecules in the close proximity od the diamond has been verified by for the detection of charged molecules (polymers) non-covalently bound to the ND surface. It was found that most sensitive are fluorinated ND, showing significant decrease in NV- PL after the addition of positively charged polymers.

The demonstrated principle represents important breakthrough for using fNDs for monitoring biomolecular processes in cells. The process was demonstrated for fNDs of size in the range of 8 –35 nm. This is significant advantage over FRET in the point of view of using a standard confocal microscope used in biological research, in which system it is easy to observe larger particles, while particles ~ 5nm or smaller, which are necessary for FRET interaction is difficult to distinguish on the resolution of standard optical microscope. In addition this effect has been modelled theoretically in collaboration of IOCB/IOP, IMEC and external partners from Academy of Sciences of the Czech Republic.

4.1.3.3.2 FRET sensing
DINAMO has developed diamond FRET, in which the (unstable) acceptor dies is replaced by small FND (~ 2-5 nm size) wit stable luminescence. This leads to enhanced stability of the detection, together with possibility to use fND as carrier. Demonstration of collocation was carried out with labelled nanodiamonds. One sample with dye (DY781-NHS) covalently linked by amid bond to the surface of amino-silanized nanodiamonds and another with Black Hole Quencher (BHQ3-NH2) strongly attached to the surface by electrostatic interacting to the negatively charged nanodiamond surface at pH 6.

To covalently bond the DY781 to the surface of the nanodiamonds as first step an oxidizing acid treatment to remove sp2 carbon was followed by borane reduction to make hydroxyl-groups. An aminosilanization was done and the FRET acceptor was bonded using its N-hydroxysuccinimide (NHS) ester derivative. Because DY781 bleaches very fast another sample with a higher coverage was prepared. To reach this BHQ was brought onto the nanodiamond surface by adsorption. Zeta potential measurements show a value of -40mV at pH 7 indicating a high surface coverage with negative charges after the oxidizing treatment. As a result, the positively charged BHQ adsorbed strongly by electrostatic interaction. The treated nanodiamonds were spin coated on a glass slide.

For the experiment USTUTT used a combination of an atomic force microscope and a confocal microscope with a Hanburry-Brown and Twiss setup and with fluorescence lifetime imaging microscope (FLIM) capability. This allows measuring the topography, confocal image and lifetime image of the same area simultaneously. We used a pulsed laser with excitation wavelength of =532 nm. Two filters were used to detect the fluorescence of the NV center and the fluorescence of the dye (FRET signal). After scanning one area the dye on the surface of the nanodiamonds was bleached by illuminating every particle with high laser power. The NV center acts as donor for both, quencher and dye. Because the acceptor molecules are not stable at high laser illumination we measured lifetime and intensity of the NV center before and after bleaching. By comparing lifetime and intensity of the NV center before and after bleaching the energy transfer efficiency was calculated. In a first step the adsorption of dye molecules on the surface of nanodiamonds was confirmed with co-localisation microscopy. Figure 3.12b shows fluorescence images of nanodiamonds with DY781. The NV channel (red) and the dye channel (green) nicely co-localize indicating attachment of dyes on the surface (Fig. 4.1.3.3.2).

Fig. 4.1.3.3.3: FLIM images of nanodiamonds with Black Hole Quencher and DY781 (a) Nanodiamonds with DY781 before and after bleaching. The lifetime of the nanodiamonds increased (b) Colocalisation of the images with NV detected (red) and dye detected (green). (c) Nanodiamonds with BHQ before and after bleaching, NV detected. Both lifetime and intensity increased. (d) Lifetime of nanodiamond before (black curve) and after bleaching (blue curve).

DINAMO has also developed a new type of FRET imaging by using graphene as electron acceptor, quenching strongly the luminescence. The recent works have demonstrates universal energy transfer distance scaling between a point-like atomic emitter and a two-dimensional acceptor. This result can be used for versatile single emitter scanning microscopes, which could image and excite molecular-scale light fields in photonic nanostructures or single fluorescent molecules. All experiments use a home-built scanning FRET microscope based on an atomic force microscope (AFM) with an optically accessible tip. Single NV centers inside nanodiamonds on the tip of the AFM are used as FRET donors. A laser beam exciting the NV center is focused through the sample onto the NV. Fluorescence of the defect center is collected through the same channel. To allow for close proximity between the defect and graphene, small nanodiamonds with diameters around "25 nm containing single NV centers were used. When the NV center is placed in close proximity to the graphene sample, Förster energy transfer quenches its fluorescence with a much higher efficiency than the 2.3% absorption observed for a graphene monolayer in the far field. In this process, an electronic excitation of the NV center is non-radiatively transferred into an exciton in graphene (Figure 1b), which quickly dissipates excitation energy mostly by internal radiation-less decay.

Fig. 4.1.3.3.4 Representation of the fND FRET experimental arrangements (a). The excitation of the NV center’s atomic dipole is converted into an exciton in graphene. Sketch of the dipole’s near field. Energy levels of the lowest optical transition relevant for energy transfer and graphene band structure near the K point (b). Fluorescence quenching (z < 5 nm) (c).

4.1.3.3.3. Nanoscale Magnetometry
Sensing weak magnetic fields is a key technology, particularly in biomedical and chemical science where the detection of Boltzmann polarized spin ensembles has proven its versatility in MRI. The Stuttgart group demonstrated sensing and imaging of stochastic magnetic fluctuations originating from freely diffusing electron spins such as paramagnetic oxygen (O2, S=1), MnCl2 (S=5/2) and Gadolinium ions (Gd3+, S=7/2) in liquids, immobilized in polymers and linked specifically to cellular structures [1]. Therefor a Nitrogen-Vacancy (NV) ensemble was used as a precision sensing array

Fig. 4.1.3.3.5: Spin contrast imaging. (a) Magnetic spin imaging. (b) T1 weighted image of lithographically patterned Gd3+ grid (blue rectangular regions with low T1) on top of diamond sensor. Three data sets: T1-decay information with varying  were acquired within tm=45 min, subsequently averaged and fitted to obtain T1 for each pixel. (c) Single- imaging (=150 µs) directly yields dark areas where Gd3+ is present due to the increased NV relaxation. Single image (tm=2 s) is sufficient to identify the pattern; the image shown was averaged for 10 min to enhance the contrast. (d) Fluorescent control image of an ultramicrotome sectioned HeLa cell (150 nm) where the plasma membrane was labeled with Biotin-poly-L-Lysine-Gd3+-DTPA-Alexa532 (Alexa532 fluorescence spectrally filtered from 550-575 nm). (e) Magnetic imaging via a single- measurement (tm=15 min, =440 µs, B050 µT) evidencing the presence of magnetic Gd3+ at the cell membrane (dark structures). (f) Line scan through plasma membrane shown in (e) demonstrating spatial resolution of 431 nm. Errors bars, 1 standard error of six independent line scans. Scale bars, 5 µm.


4.1.3.4 Cellular imaging of ND devices for monitoring of oncogenic process (WP4)

DINAMO has explored fluorescent nanodiamonds as drug delivery vehicles and biomedical imaging probes. The first step towards clinical translation of NDs is the assessment of their biocompatibility. DINAMO has completed the most comprehensive analysis of the cellular compatibility of NDs to date. In addition, NDs have been utilized for as an imaging and delivery vehicle for cancer diagnosis or therapy.

4.1.3.4 .1 Benchmarking of NDP incorporation and functionality evaluation in real time
DINAMO compared the cellular response to different types of NDs: unmodified or functionalized detonation NDs (DNDs) and fluorescent HPHT NDs (FNDs). We first assessed the impact of the DNDs and HPHT NDs on two cancer cell lines: HepG2 (hepatocellular carcinoma) and HeLa (cervical adenocarcinoma) the broadly used representatives of liver and epithelial cell types. Varying concentrations of NDs (1mg- 1ug/ml) were incubated with both cell lines for 24 hours prior to assaying for metabolic activity (XTT or Wst1assays), cell death (lactate dehydrogenase release) or apoptosis (Annexin V/PI, caspase 3/7 activation), and on transcriptional level (proliferative markers Ki-67 and c-Myc). NDs induced a similar response in both cell lines. At the highest concentrations (1mg/ml), both the DNDs and ND-NH2 reduced the overall metabolic activity in the HeLa cells. However, this effect was not accompanied by an increase in cell death or apoptosis, as evidenced by a lack of release of the intracellular enzyme lactate dehydrogenase and no observed caspase activation. Taken together these results indicate that at extreme concentrations NDs inhibited proliferation in the HeLa cells. However, at slightly more reasonable concentrations (<500µg/ml) neither the DNDs nor the HPHT NDs had any effect on cellular metabolism, cell death or caspase activation. Similar to the HeLas, the DNDs and ND-NH2s had no impact on the cells at more reasonable concentrations (<500µg/ml). For comparison, if used to deliver the chemotherapy drug doxorubicin a mouse might see a total dose of 500µg DND, which is far less than treating a small number of cells with 1mg/ml. NDs were extremely well tolerated by cells regardless of subtype of or surface modification, even when treated with concentrations well above what would be used therapeutically.
Evaluation of the immunogenicity and sensitivity to immune effector mechanisms
First the optimal size of HPHT NDs was analyzed by induction of apoptosis and activation/inhibition of immune cells. We ascertained that NDs of 10-50 nm size do not influence the cellular apoptotic events and induced the monocyte activation and maturation, while the 120-150nm NDs had an opposite effect, potentiated the apoptosis and inhibited monocyte activation. On the other hand, lymphoid cells (B, T, NK) were significantly saved before apoptosis by NDs of 20-50nm and induced the expression of very early activation antigen (CD69) on B and NK cells. Comparison of DNDs (8nm) and HPHT NDs (35nm) did not show significant differences in cell viability or activation. On the other hand, the surface chemistry (-COOH, -NH2, -peptide, -saccharide) partially, but not significantly changes the biocompatibility of NDs.

Fig 4.1.3.4.1: Mixed dendritic cell (Green) HT29 colon cancer cell line (yellow) culture after 24hrs of incubation with fNDs.

Route of internalization of NDs after 24 hrs into IC21 cell line analyzed by electron microscopy is shown in Fig 2. We found out that both the small 8nm detonation NDs and the 35nm HPHT NDs are internalized by cells and transported into the cytoplasm by endosomes.

Fig. 4.1.3.4.2: HPHT NDs 35nm (left); DNDs 8nm (right) are incorporated into endosome.

4.1.3.4.2 Determination of NDP-devices influence on cellular processing in cancer cells

Small size (8nm) DNDs as drug delivery agents
One of the major advantages of DNDs as a drug delivery vehicle is their ability to deliver anthracycline chemotherapeutics in a controlled manner. Previous work on nanodiamond doxorubicin demonstrates that nanodiamond mediated delivery of doxorubicin overcomes chemoresistance and virtually eliminates drug toxicities. Here we evaluate the cellular response to ND delivery of daunorubicin, another commonly used anthracycline chemotherapeutic. Similar to ND-doxorubicin, ND-DNR was synthesized by sodium hydroxide precipitation. Both HepG2 and HeLa cells treated with ND-DNR or daunorubicin alone for 4 hours tolerated the ND-NDR better than the free daunorubicin; induced less cell death and less caspase activation than plain DNR. We observe here that ND-DNR is less toxic to multiple cell types than free daunorubicin, indicating that it may be better tolerated than the free drug when administered intravenously.

Fig 4.3: ND-DNR is less toxic than free daunorubicin. HepG2 cells were treated with equivalent concentrations of ND-DNR or daunorubicin for 4 hours prior to assaying for metabolic activity (left), cell death (center) and apoptosis (right). (*p<0.05 **p<0.01 ***p<0.001).

4.1.3.4.3 Targeting of HPHT FNDs to HER2/neu receptor overexpressed on adenocarcinomas
Fig 4.1.3.4.4: Confocal images of FND samples targeted to HER2/neu by complementary peptide sequence in MCF7 breast cancer cell line with high expression of HER2/neu marker (upper) and MCF7 with suppressed HER2/neu expression. Cells were incubated 24 hours with targeted FNDs and subsequently 30 min. with HER2 specific monoclonal antibody (Herceptin). The number of NVs per spot had been marked with yellow numbers (left) under the same experimental conditions (exc. 532nm @ 100 mW) and after bleaching. As a negative control we used macrophage cell line spontaneously incorporating FNDs, where unspecific FND-Her2/neu distribution inside the cells was detected (not shown).

4.1.3.4.4 Verification of molecular interactions and NDP-vector evoked RNA/DNA
To evaluate the suitability of the FND as a detection system in diagnostics we checked luminescence in different body fluids as potential as diagnostics. We didn´t see any significant influence of urine and feces that could potentially interfere with FND luminescence.

Fig 4.1.3.4.5: Luminescence spectra in different body fluids of rats with colorectal cancer - urine (black), plasma (red), and feces (blue); human samples showed similar results.

To ensure representation of miRNA template in the particular type of sample we have developed a quantitative real-time PCR from tumor tissues and we applied that method to plasma samples which is one of the body fluids planned to be used in non-invasive diagnostics. MiRNAs related to colon cancer, miR-21, miR-135, and miR-143 were synthesized and verified by GeneriBio were optimized for real-time RT-PCR in rat tumor tissue (miR-21, 135 and 143) using FAM labeled probes, and detected the levels of miRNAs in distinct stages of carcinogenesis. We detected generally lower amount of microRNA in plasma from tumor-bearing rats (average 50ng in tumor and 200ng in control samples). This phenomenon could be explained by the fact that tumor samples undergo extensive hypermethylation and thus a lot of microRNAs promoters have been silenced.

Fig 4.1.3.4.6: The level of miR-143 lessened in all adenoma and carcinoma or metastatic tissues and this down-regulation started early in carcinogenesis Fig xy (left). For verification of miRNA functionality we have been optimalizing transfection of miR-143 containing plasmid and transfection into primary HT-29 and metastasizing SW-620 colon carcinoma cell lines (right). (NTC: non-treated control, FG: Fugene transfection solution only, TR: cells transfected by miR-143). NDs for cell transfection - Complexes of FNDPEI800 were used to bind partial sequence of DNA coding beta-actin (137bp). Intake of nanodiamond particles has been confirmed by confocal microscopy.

Fig 4.1.3.4.7: Comparison of luminescence of FAM labeled NA bound to FNDs exhibits both signals outside the cells or soon after cytoplasm entry (DAPI-blue, FAM-green, FNDs-red, merged-yellow (upper series-1h). After entering the cytoplasm, the FAM signal disappeared (lower series of images -2hrs). Luminescence spectra (see also Fi.g.8) measured outside and inside the cellular compartment demonstrated the changes in NV- luminescence spectra. Spectral intensities were normalized to the GAPDH determined with Bio-Rad iQ5.2.0 software. All samples were performed in biological and technical triplicates.
Fig 4.1.3.4.8: Wst-1 assay of HT-29 cells after 24 hrs incubation in the presence of FNDPEI800 and FNDPEI60000 complexes (up). Luminescence spectra monitoring of NA delivery processes using PEI800 and PEI60000 coatings bound to fND. Measurements are performed in water (upper figures) and comared with cell response (in the centre).

PEI800 exhibited better properties for FND-based detection of hybridization changes, compared to poor intensity of recovery after PEI60000-DNA binding. Moreover, FND-PEI60000 resulted in significant impairment of mitochondrial activity. FND-PEI complex is non-toxic and thus suitable as a delivery vehicle for transfection of nucleic acids into cellular systems. FND-PEI800 complexes are biocompatible and can serve as a delivery for transfection of nucleic acids into cells enabling easy NA detection and in the future it can be used for NA-based therapy.

4.1.3.4.5 Ex -vivo and in vivo visualization of NDP delivery
Fig. 4.1.3.4.9: Intraperitoneal injection of fND-PEI800-GFP complex (124ug/mice) into CRC-bearing mice; after 18hrs in vivo started the expression of GFP protein in peritoneal macrophages (upper images); and further 24 hrs incubation in vitro shows a similar image (lower panel).

Nanodiamond lipid hybrid particles (NDLPs) were designed to provide active targeting of ND-complexes without interrupting the beneficial interaction between the diamond surface and small molecule therapeutics or imaging agents. We synthesized, characterized and evaluated NDLPs targeted to the epidermal growth factor receptor. We found that the completely self- assembled NDLPs are readily scalable and highly adaptable platform for targeted imaging and therapy. NDLP selectively image and effectively treat EGFR-overexpressing breast cancer cells both in vitro and in vivo. Epirubicin-loaded NDLPs mitigate drug-induced mortality and markedly increase treatment efficacy when compared to epirubicin alone. Furthermore, NDs and NDLPs are extremely well tolerated when administered to mice. Comprehensive serum chemistry and hematological analysis completed after intravenous administration of NDs and NDLPs showed no evidence of systemic inflammation or specific organ damage. These studies represent the most comprehensive in vivo evaluation performed on NDs to date. NDLPs are a scalable, biocompatible and modular platform for the delivery of a wide variety of biological agents, representing an important advance in targeted chemotherapeutic delivery.

Fig 4.1.3.4.10: NDLPs effectively treat EGFR-overexpressing tumor xenografts in mice. Female nod/scid mice bearing MDA-MB-231 tumor xenografts were treated weekly with 150µg of epirubicin or equivalent dose of NDLP (*p=0.006 **p=0.0006).

Potential Impact:
Figures are provided in the attachment

4.1.4. Potential Impact
4.1.4.1 Potential Prospect for Cancer Diagnostics Market
It is expected that cancer will peak to over > 30 Million new cases by 2020 in the US and EU only, growing at a rate of ~12 %. The global market for cancer drugs was expected to cross US$ 78 Billion by 2012. The total nanomedicine medical market, predicted for the medical device sector and associated equipment market was predicted to be US$246 billion by 2012. Equally, this market sector is expected to grow steadily by an average of 4.6% per year over the next 5 years. Cancer vaccines record the fastest growth rate as the drug manufactures are now focused on developing targeted therapies. These drugs attack target cells and thus limit the severity of side effects. In this aspect DINAMO can bring important benefits to cancer research. DINAMO has introduced novel in vitro techniques that can be applied for monitoring cancer processes impacting cancer research. fND can be used for real time monitoring of cancer cells leading to understanding of cancer development dynamics, early diagnostics and combined with delivery of chemical drugs. fND is at the cutting edge of possible applications, however follow up developments have to be carried out to valorise the research results developed by DINAMO. Major achievements of DINAMO applicable in future to nanomedicine for cancer therapy includes enhanced drug therapeutic efficacy; by combining the drug with fND the selective targeting of cancerous cells and the ability to track drug import can be achieved. This research result has important potential application and has been in detailed studied by the partner NorthWestern. The obtained results are inline with the advancement of next-generation nanocarriers as a drug delivery platform that will require reduction of adverse side effects of chemotherapy drugs and overall treatment and diagnosis improved efficacy. As such, a variety of nanoparticle-based delivery systems have already been widely investigated and provided interesting avenues of research for improving cancer treatments through therapy and targeted delivery. fDN advantage is not only in the biocompatibility but also in a combination with simultaneous tracking (not bleachable and stable) and even sensing of delivery events.

Herein, DINAMO has made first major step on an inclusive multicomponent nano- diamond (ND)-based drug delivery system with simultaneous capabilities in targeting and imaging. DINAMO has synthesized a versatile ND constructs that incorporate a targeting agent, imaging agent and chemo- therapeutic agents for multimodal imaging and therapeutic applications. The enhanced therapeutic efficacy and specific internalization within cancerous cell lines is then observed and evaluated. As an example, paclitaxel (PTX), a chemotherapeutic which causes cell death by interrupting the polymerization dynamics of tubulin during cell division and interphase, remains as one of the most frequently used antitumor drugs against ovarian and breast cancer today. Although highly effective, several challenges associated with drug administration remain, most notably side effects due to solubilisation agents and drug resistance among others. Within this construct, PTX molecules are attached to the fND surface via fluorescently labelled oligonucleotide strands. Polyvalent DNA functionalization of nanoparticles has also been extensively studied and utilized in a variety of biological applications, including nanomedicine, diagnostics and self-assembly. The programmable and versatile chemistry afforded by oligo-nucleotide synthesis is especially useful in drug delivery, as the simultaneous linkage and intracellular tracking of conjugated therapeutics to the ND surface that can be accomplished in an integrated manner. Active targeting of drugs in a cancer diseases involves the specific targeting of antigens within tumours of interest. Through ligand-target biorecognition of tumour cells, the toxicity to healthy surrounding cells can be minimized by using fNDs. These potential applications can be used in follow up developments and new projects and bilateral contracts with industries.

4.1.4.2 DINAMO potential for exploitation
The NDP production and optimization including engineering optical and MR imaging probes.
The fND fabrication was pioneered by the DINAMO consortium and led to maintaining Europe’s leading position in producing fND as a probe for biological applications. The high energy particle irradiation of fNDs allowed production of fND particles with defined number of NV color centres and further processing led to defined surface termination that is important for constructing molecular assemblies. The fNDs fabricated were of sized ranging from several nm to about 100 nm. Several possible irradiation and NV production strategies have been implemented, leading to the optimization of the NV fabrication process. As a result, the DINAMO partners have discovered proprietary technology for production of NVs with very high yields. Such fNDs are today not commercially available and their production can be of high potential interests. Specific arrangements for the irradiation geometry have been developed, including irradiation in liquid targets that enable production of high amounts of fND in one irradiation run. As a consequence of this development fND can be produced at high amounts and with relatively low costs. This is an important fact, enabling using fNDs in pharmaceutics applications for the production as biomarkers.

The production technology developed, and this specifically the water based irradiation targets, is a subject of patent application in preparation. DINAMO project deliverables will yield novel fNDs that are believed to have important potential impact as active biomarkers/drug delivery carriers. fND is rather novel material in nanotechnology however already several companies in the Asia, Russia or Europe are active on the market and could be interested in the project results. None of these companies produce luminescent ND with specific properties described in DINAMO and using optical fluorescence and electron spin processes, which are characteristics developed uniquely in the DINAMO project. Specific supramolecular structures on the surface of fNDs, which DINAMO developed, relate to new Hi-Tech functionalities with important potential for medical industries. The strategy for implementation of these results will be based on the patenting the technology and marketing and negotiating with fDN production companies, that is going beyond the DINAMO project. Some of the partners are interested themself to generate potential spin-off with fND production. IOCB has submitted patent for specific applications of ligands to be used on conjugation with fNDs.

Nanotechnology solutions in cancer treatment represents a new prospective directions. There is important role in the materialization of the nanotechnology routes to be played by advanced SMEs. One of such SMEs is represented by GENERI BIO in the consortium, working on DNA pharmaceutics and collaborating with larger industries. GENERI BIO is highly interested in potential applications. The first field is the use of the results in the existing techniques that are commonly used and bring some innovation into it, e.g. by increasing sensitivity and/or expand the use of existing techniques. In this field the main potential lays in the fluorescent properties on fND`s – the most widespread technique in the field of molecular diagnostics is real-time PCR technique. In this technique the fluorescent labelled DNA probes are used but facing the problems with fast “fading” of fluorescence. There exist one of the yet commercially available solution, the “quantum dots” - however the use of these molecules in live cells is very limited. One of the reasonable exploitation of the DINAMO results is therefore the use of fND`s as a new labels in existing applications. GB is producing the fluorescent labelled nucleic acids and would like to have usable fND`s available for standard nucleic acid labelling methods. However there is a need to have properly functionalized fND and/or validated method for oligo-modification by fND and purification thereof. This opens a gate for a short-term commercialization task.

The second field is the use of the results in the form of rather new and “breakthrough” technologies in the molecular diagnostics. The molecular diagnostics is overwhelmed by the real-time PCR (or quantitative PCR, qPCR) technique. It is foreseen than the qPCR technique will soon start to be replaced by “other” techniques (some of them are “rising” i.e. next-generation sequencing etc.). These “new” techniques have to carry significant improvements over the commonly used (and very established) qPCR technique. The possibility of changing the fluorescent properties of fND`s by manipulating the electric charge shell properties around the fND core is very promising. One can imagine commercialisation of the DNA probe with the sequence hybridizing to the target sequence that is present or in increased concentration at some disease state. This is a common ground of many molecular genetic tests used in diagnostics. If the hybridization of such a sequences to the fND labelled by complementary probe sequence would change detectably the fluorescent properties of the fND it will perfectly fits the condition of bringing significant improvement in the field.

Vectors for nucleic acid therapeutics or act as multi-modal imaging nanoparticles
The surface modified NDPs and the surface assembly of NDPs with bioactive molecules to form NDP-based devices were demonstrated, that will allow using fNDs as vectors for nucleic acid therapeutics or act as multi-modal imaging nanoparticles for the imaging of disease-specific biomarkers or pathologies as part of early detection or the monitoring of therapy in real-time. DINAMO has worked on developing linker strategies allowing to produce fNDs with grafted supermolecular assembly and developed specific biologically interesting systems that can be used for the cellular targeting as well for oligo-nucleotide delivery. Among various systems, interesting is specifically HER2 and bombesine that were successfully tested for targeting in various cancer cell lines. The grafting strategy are proprietary and can be utilized for different applications in cancer cell research.

4.1.4.3 Summary of FND impact in cancer research
• The exceptional feature of FNDs, the bright non-bleachable and non blinking fluorescence based on NV centers could be applicable in immunohistochemistry as a sensing tool, where the commonly used fluorophores are problematic due to background fluorescence histological samples.
• The physical characteristic of NV- to NVo spectra luminescent changes are detectable by confocal microscopy and could serve for real-time monitoring of molecular interactions such as DNA/RNA hybridization or receptor-ligand interaction outperforming the currently used techniques. This platform discovered by the DINAMO, opens wide potential for contactless cellular sensing with ultra high resolution (super resolution ~ 20 nm).
• DINAMO developed proprietary procedures for chemical targeting by grafting fNDs with specific biomolecules, identified or developed for this purpose and having high application potential. Targeted FNDs are applicable as a probe in tracking/monitoring of cancer cells in in vitro and ex vivo samples visualized even using commercial confocal microscopy, and as a diagnostic tool for identification of cancer progression.
• ND-PEI800 complexes 70x enhance the delivery efficacy of RNA/DNA with maintained biocompatibility over PEI800 alone, and is several times more effective in knock down of genes compared to lipofectamine. Similarly, the GFP expression or silencing is promoted by NDs. The DINAMO developed technology of FND-PEI- DNA technology is of high commercial interest with GENERI bio being a potential producer of this platform.
• The results that appending on the DINAMO research relate to spontaneous incorporation of fNDs (8-150 nm size) by phagocytic antigen-presenting cells is advantageous for transportation of antigenic peptides, glycans desirable for presentation to T-lymphocytes, subsequently inducing the effective antimicrobial or antitumor immune response. FND-PEI-NA complexes specifically internalized by APC/DCs in vitro as well as in vivo can be an effective transfection method with plasmids bearing DNA sequences encoding cytokines or tumor antigens to induce improved cytotoxic T-lymphocyte effector functions. Specific antigen answer can be presented to effector lymphocytes, This system has potentials in immunomodulation and immunotherapy (antigen and anticancer therapy and it is potentially patentable after further development).
• Small NDs (5-8 nm) as drug delivery agents potentiate the therapeutic effectiveness of anticancer drugs also to drug resistant tumor cells and CSCs with concurrent decrease of toxic side effects. Thus, NDs have a potential to be translated into preclinical evaluations and clinical trial beyond the DINAMO project.
• Encapsulation technique developed by IMEC (FNDs encapsulated to PLLA or other polymers) can be combined with drug and/or targeting molecules and broaden the spectrum of their utility to theranostic applications.

Interdisciplinary research on nanoscale Imaging
DINAMO dealt strongly with super resolution real time nanoscale imaging of molecular interactions in cells, that allow new venues in the cell imaging, vital for the future of EU industries. The development of this expertise was carried out at the individual beneficiaries, led by University of Stuttgart, enhancing the competitiveness of EU research in this field. USTUTT has developed several super resolution cellular monitoring technique based on the nitrogen-vacancy centre in diamond as an unique solid state system that allows ultrasensitive and rapid detection of single electronic spin states under ambient conditions. This is the base to develop sensors for magneto-optical spin detection systems for novel commercial sensors. The NV centre can be read out in an ensemble or down to single center level and used for versatile sensing applications for life science and material research.

Fig. 4.1.4.1: Sensing options for a diamond defect sensor. For high sensitivity the defects are implanted below the diamond surface (≈ 5 nm).

To benefit from ensemble sensing sensitivity, the Stuttgart group employed an array of atomic sized NV sensors (~1000 µm-2) approximately 5 nm below the diamond surface. To receive the magnetic information of larger areas in ultra-pure diamond substrates were bought and the nitrogen was implanted in the substrates with an implantation facility available in the 3. Physical Institute in Stuttgart. Figure 5.2 shows the schematic of a microfluidic device where the NV-centre array is used to sense molecules and ions with electron spin in a passing liquid (e.g. Gd3+ ions).

Fig. 4.1.4.2:.Schematic of a microfluidic device with an integrated NV center array.

An actual version of such a microfluidic device is presented in Figure 4.1.4.3.

Fig 4.1.4.3:. Microfluidic cell mounted above the objective. The real sensor in the angled and 80 µm thick diamond, which surface with the shallow implanted NV-centers forms the floor of the µm-sized tube in the middle of the structure.

To monitor the signal on the sensor a CCD-camera is used. Such wide-field detection allows at the moment simultaneous readout of a 60 x 60 µm2 optical field of view with an effective pixel size close to 100 nm. Such a sensor could not only be used to monitor atoms with electron or nuclear-spin in material science (e.g. battery processes), but even processes in living cells that cause magnetic field fluctuations (e.g. the production of free radicals in cell death or the change of the membrane potential in neurons) could be directly visualized in real time.

Furthermore a sensitive magnetometer to measure the strength and the orientation of magnetic fields in the environment has been developed together with an industrial partner. Components (e.g. laser, optic, microwave generator, detection system) that once required a whole optical table have now in total the size of an 1 liter soft drink wrapping with the goal to shrink it further to the size of a laser pointer. This device is very robust and does not require dedicated working conditions like ultrahigh vacuum or low temperature to preserve the high sensitivity. In Figure 4.1.4.4 such a novel magnetometer is presented.

Fig 4.1.4.4: Magnetometer based on NV-centres in diamond. The shown version 3.0 consists of 2 parts: The magnetometer (case is removed for a better view) and a standalone CPU with screen. It is already portable and could be powered by battery.

The magnetometer has a sensitivity of 7nT being in the range of previous research instruments. It is also optimized for low power consumption and thus in principle being capable of stand-alone operation.

List of Websites:

http://www.fp7-dinamo.eu(se abrirá en una nueva ventana)