Skip to main content
Przejdź do strony domowej Komisji Europejskiej (odnośnik otworzy się w nowym oknie)
polski pl
CORDIS - Wyniki badań wspieranych przez UE
CORDIS
Zawartość zarchiwizowana w dniu 2024-06-18

Macrophage Systems Biology Applied To Disease Control

Final Report Summary - MACROSYS (Macrophage Systems Biology Applied To Disease Control)


Executive Summary:

The MacroSys project addressed the genetics of susceptibility of cattle to diseases caused by mycobacteria, Bovine tuberculosis (TB), which is caused by M. bovis, and is a significant zoonotic disease of cattle, and Left unchecked, TB can have significant economic and health consequences for cattle and people. Johne’s disease (Para-TB), which is caused by M avium subsp. paratuberculosis (MAP). Para-TB causes chronic enteritis which in dairy cows is characterised by a drop in milk production, followed by progressive loss of condition and weight, and eventually death. Johne’s disease has been linked with the occurrence of Crohn’s disease in man. The striking feature of mycobacterial infections is the prolonged incubation period. These diseases progress slowly and animals may only become clinically ill after two to six years following infection, while some infected animals may not progress further to clinical disease.

The MacroSys project used a combination of functional and classical genomics, together with system biology approaches to investigate host-pathogen interactions and the host immune response to mycobacterium infection. These studies contributed to knowledge of macrophage function and the genetic control of the host response to mycobacterial infections.

Results obtained

Background information.

The project has a dedicated website (www.macrosys-project.eu) that presents the project objectives and includes collated information on publications related to mycobacterial infection and macrophage function.

In vitro infection studies of gene expression.

An experimental model using monocyte derived macrophages was used to study in vitro infection with two genetically distant strains of M bovis and two MAP stains. RNA from infected cells and controls was sequenced to explore macrophage response to in vitro infection. The data show that there are significant quantitative and qualitative differences in transcriptome responses depending on pathogen and strain.

Testing gene function.

Reliable methods for targeted gene knock down were developed using transfected small interfering RNA (siRNA). This approach was used to study the role of target genes in progression of mycobacterial infection.

Genetic studies.

Analysis of field cases of 500 MAP infected cattle and 500 controls in a “Genome Wide Association Analyses” (GWAS) identified loci, on chromosomes 12, 8, 9, 11 and 27, significantly associated with antibody response to MAP infection. A second study using both faecal culture and serum antibodies as the measure of MAP infection status in 192 cows, identified loci associated with disease on BTA 4 and 20. A meta-analysis of the GWAS data identified further loci on BTA 1, 6, 13, 16, 21, 22, 23 and 25 associated with disease status. Bioinformatic analyses identified genes within the significant regions and revealed common physiological pathways that indicated potential functional links.

Final results and their potential social impact.

Information from the project on genetic susceptibility to disease caused by mycobacteria may be used in cattle breeding to reduced susceptibility to TB or para-TB, and hence lower the rate of infection at the population level. The study of the response of macrophage to infection with mycobacteria and expression knock down studies increased understanding of the biology host pathogen interactions. This information may contribute to the development of better diagnostic tests for preclinical phases of disease for use in disease control programs. The outputs of the MacroSYS project may impact on frequency of mycobacterial disease and hence contribute to improved efficiency and profitability of animal production and better animal health and welfare, thus underpinning the competitiveness of agriculture within the overall framework of European policies on sustainability.

Project Context and Objectives:

BACKGROUND

Context

Cattle farming is one of the most important agricultural activities in the EU. Dairy production accounts for about 18 % of the total value of agricultural output. Milk is a source of nutrient both as raw milk and dairy products and beef in many forms is a central part of the diet in many households. The health of the cattle population in Europe is a central concern, as this impacts both on production efficiency, and hence sustainability of the industry, and also health and safety of cattle products. The MacroSys project focussed on diseases that increasing in European cattle population and are of growing concern elsewhere. Two related diseases were targeted, bovine tuberculosis (TB) and bovine paratuberculosis (Para-TB or Johnes disease). These are chronic diseases caused by mycobacterial species (Mycobacterium bovis and Mycobacterium avium paratuberculosis - MAP, respectively) that invade and survive within a specialised immune cell, the macrophage. These diseases are a major problem for productivity, herd health and animal welfare. TB is a confirmed threat to human health, while Johnes disease has been linked to Crohn’s disease in man.

There are two distinct immune pathways, innate and adaptive immunity, with which the individual combats infection. Innate immunity provides the first line of defence against invading pathogens and includes macrophages that have many function, including cytokine production to stimulate immune responses in other immune cell types, killing of microbes, and processing and presentation of antigens to lymphocytes. The main route of infection by mycobacteria, for M. bovis is predominantly respiratory, while the route of infection for M. a. paratuberculosis mainly oral. The macrophage is the primary line of defence and is the key cell with the potential to control the mycobacteria infection. Tissue resident macrophages phagocytise the invading bacteria. However, many species of mycobacteria are able to avoid the macrophage lysosomal activity that would normally result their destruction and histological evidence shows that the are able to reside within macrophages in vivo for long periods

The MacroSys project focused on understanding the role of the macrophage response to mycobacterial infections in cattle and the genetic components involved in disease progression. The overall objective was to create new knowledge to help control mycobacterial diseases, and possibly bacterial diseases in general.

Target diseases

Bovine tuberculosis, caused by M. bovis, is a significant zoonotic disease of cattle in many countries worldwide. Left unchecked, the disease can have significant economic and health consequences for cattle keepers and their communities. In developing countries, in particular, these include loss of animal productivity due to reduced milk and meat output, lower reproductive success, diminished market opportunities and poor work capacity for farming and transport. Human tuberculosis caused by M. bovis is clinically indistinguishable from tuberculosis caused by M. tuberculosis and there is significant zoonotic transmission of M. bovis in regions that lack basic medical infrastructure.

Johnes Disease (Para-TB), caused by M avium subsp. paratuberculosis (MAP) results in chronic enteritis in a wide range of animal species. The DNA insertion element IS900 is unique to MAP which allows it to be differentiated from the other Mycobacterium avium sub species. MAP is resistant to drying, freezing, acid and to many disinfectants, and can survive for months and even years in the environment. The striking feature of MAP, and other mycobacterial infections is the prolonged survival of the bacteria in the lysosomes of macrophages. The disease progresses with the slow development of lesions in infected animals. Clinically signs are seldom seen before two following infection and a large proportion of infected animals do not progress to clinical disease and may become resistant after the development minor lesions in the gut. The clinical phase of the disease is characterised by a gradual loss of condition. In dairy cows a drop in milk production is observed before any overt signs of disease. As the disease progresses animal loose condition and weight and at later stages can shed billions of bacteria per day infecting other stock.

Detection and Surveillance

In man detection of early tuberculosis infection is achieved by measuring the cell mediated immune responses, which involve recruitment and activation of a variety of T cells to the site of infection. Several immunological diagnostic assays based on these immune responses are effective in diagnosing tuberculosis both in cattle and humans. The most widely used screening test for the diagnosis of tuberculosis is the tuberculin skin (Mantoux) test which detects the cell mediated immune response to TB derived proteins. Where the prevalence of tuberculosis is high, the skin test can be very effective in identifying infected populations. However, due to a lack of absolute sensitivity which is typically 70-90% there are limitations in the usefulness of the test to detect all infected individuals. Routine testing of cattle populations for TB infection is carried out in Europe by skin testing.

Diagnosis of MAP infection in the pre-clinical stage in cattle is difficult, largely because of the prolonged incubation period and slow progression of the disease in the animal. In the early stages of infection there are few, if any, organisms shed in the faeces and little or no detectable humoral immune response. The culture of the organism from faeces is considered by most authorities to be the most sensitive and highly specific test available for the diagnosis of the preclinical phase of MAP infection in the live animal. However the detection rate can be very low. In addition, if animals ingest large numbers of organisms from a heavily contaminated environment, it is possible for them to pass through the gut and give a false positive on faecal culture. Serological tests are attractive for the mass screening of cattle, however, antibody response to MAP occurs late in the progression of the disease and some animals that show clinical disease fail do not produce antibody. The absorbed ELISA is now the standard serological test for paratuberculosis in cattle and has a sensitivity of 87% for animals identified as clinically affected. However, for animals that are light shedders of MAP with no clinical signs sensitivity can be as low as 15%. A test with high sensitivity of detection at pre-clinical phases of the disease are urgently needed.

Genetics of susceptibility

There is substantial genetic variation in TB susceptibility in red deer with an estimated heritability of 0.48. For dairy cattle susceptibility of daughters is correlated within specific sire families providing evidence that TB susceptibility is genetically influenced. There is some evidence for the influences of the cattle breed on the occurrence of paratuberculosis. Analysis of disease occurrence in families suggests a heritability of 0.10. Thus there is also evidence of a genetic component of susceptibility to MAP. Knowledge of the genomic factors and genetic variations associated with differences in susceptibility mycobacterium infection could be incorporated into breeding programmes to reduce infection rates and hence improve herd health and reduce the environmental burden.

SPECIFIC SCIENTIFIC AND TECHNICAL OBJECTIVES

Overall objectives

The objective of the MacroSys project were to use combined functional genomics and system biology approaches (systems genetics) to investigate host-pathogen interactions and the host immune response to myco-bacterium infection. The project undertook activities to provide evidence to identify those genes that are important in regulating and modulating the infection process and progression of disease. Thus overall objectives were to:

1) increase knowledge of macrophage function, and specifically the response of the macrophage to mycobacterial infections
2) identify genes that regulate the response of an individual to infection

To reach these overall objectives the project was conducted in 4 phases and had a series interconnecting work packages (WP) with specific objectives.

Scientific and technical objectives

The objective of Phase 1 was to assemble data on genes involved in response to mycobacteria infection. The data was obtained from three from sources 1) a literature (WP1); 2) experimental studies using an in vitro model system that was established in WP2 then used in WP3 to examine gene expression patterns in macrophage infected with different strains of M bovis and M avium; and from high density genome association analyses localise genes involved in variations in Johnes disease incidence.

Phase 2 assembled the data from Phase 1 for analyses in WP5 to build gene interaction models and identify key pathways involved in regulating the infection process. Well supported, prioritised candidate genes will be identified from the analyses. The unique and important contribution of the proposed project will be the direct testing of candidate genes and pathways in vitro.

Phase 3 had the objective of testing the data from Phase 1 and the analysis in Phase 2 at the level of expression and genetic response. Therefore, and experimental system to perturb the expression of these key target genes and pathways was developed in WP 6 to test eth effects of knocking down expression of candidate genes on the infection process and survival of bacterium in the macrophage. The assessment of genetic associations of candidate genetic loci were tested in a large population in WP7

The final Phase 4 of the project had the objective of bringing together the results obtained in the previous 3 phases (WP8) to assess if the feasibility of using the information produced to improved the control of mycobacterium and prevalence of disease caused by these pathogens.

Project Results:

Overview

The outputs of the MacroSys project included the development of techniques and standardisation of methodologies, and the creation of new knowledge and information with the potential for application. Two methodologies developed in the project were an in vitro infection model for exploring the impact of macrophage infection in vitro on gene expression and hence function of the macrophage and the second was a macrophage gene knock down system for exploring the effects of knocking down the expression of candidate genes on the macrophage response. New knowledge created by the project was generated using these technologies and identified genes with modified expression as a response to macrophage infection. In addition a genetic study identified genomic loci that are associated with antibody response to mycobaterium infection.

The methods developed and the specific results obtained in the MacroSys project are presented below.

1) Establishment of a macrophage infection model

Host cells

Macrophages play a primary role in innate immunity by detecting potential pathogens though a repertoire pathogen antigen recognition receptors, including Toll-like receptors (TLRs). They then respond through phagocytosis of the invading pathogens, and production of cytokines and other effector molecules including antimicrobial peptides. Macrophages also function as a bridge between the innate and adaptive immune responses by acting as antigen-presenting cells and directing T cell responses that may result in cytotoxic killing of infected cells or stimulate a humoral immune response. The ability of mycobacteria to influence the macrophage and subvert their response may be critical to the establishment of infection and progression to disease.

The macrophage targets in vivo differ between the two mycobacterium species, the primary route of infection for TB is via the lungs and likely targets are alveolar macrophages, whereas for MAP infection is mainly via an oral route and hence the primary cells that are gut associate macrophages, or dendritic cells. However, these cells are not easily accessible. To create a simple the model system, blood was used as a source of cells. Circulated monocytes purified from blood can be readily differentiated into macrophages and can be infected in vitro with various species of mycobacterium

Cell preparation

Primary bovine monocyte derived macrophages should be prepared from fresh blood collected in acid citrate dextrose as anticoagulant from cow from a Johnes and TB free herd. Fresh blood should be diluted in PBS and layered on to Histopaque-1077 and centrifuged. Mononuclear cells are collected from the PBS-Histopaque interface and washed. The isolated mononuclear cells are then diluted and grown in culture for 12 h in RPMI 1640 tissue culture medium supplemented with 12% fetal bovine serum, 2mM L-GLN, 0.1% 2-b-mercaptoethanol at 37°C and 5% CO2 to allow monocytes to adhere. Non-adherent cells are then washed off the plates and adherent monocyte cells allowed to differentiate in culture for 5–7 days in the same medium. Differentiation on monocytes into macrophages can be confirmed by observing the changes in cell morphology under a light microscope.

The monocyte derived macrophages are prepared for further studies by detaching the macrophages from the culture plates using cell dissociation solution (Sigma-Aldrich), washing in PBS and reseeded at 0.5 x 106 cells/ml in 25 ml flasks. This number of cells will yields about 10ug of total RNA.

Mycobacterium strains

The outcome of infection by the human-adapted pathogen, M. tuberculosis is influenced by the ‘strain’ of pathogen involved. This variation is related to variations in the ability of different strains to regulate the expression of key cytokines. Classification of strains of M. bovis by molecular sub-typing is useful as an epidemiological tool. There is preliminary evidence that different M. bovis strains differ in their ability to induce a cell-mediated response in cattle. Strains of MAP can be distinguished by examining the site of insertion of the IS900 insertions sequence and by genotyping at microsatellite loci in the genome sequence. Whether different strains or subtypes behave differently with respect to infection or development of disease is not known.

MacroSys project used two divergent strains of M Bovis and two strains of MAP to examine whether the different specie and strains of mycobacterium elicit different responses in infected macrophage. M. bovis isolates were from Great Britain; AF2122/97 (spoligotype SB0140, lineage A) and G18 (spoligotype SB0129, lineage P). MAP, strains L1 and C were isolated from farms in from Italy and showed different microsatellite sequence profiles. Strain C was isolated from a farm with high incidence of clinical cases of Johne’s disease, including in young animals. Strain L1 was isolated from a farm with very low incidence of clinical Johne’s disease. The four isolates were cloned than grown to mid-log phase in liquid medium. The Mycobacteria were then harvested and prepared as single cell cultures then frozen at 1 x 107 cfu/ml.

Infection model and preparation of RNA

Frozen Mycobacteria stocks were thawed and prepared in RPMI 1630 medium and inoculated at MOI of 5 or 10 for M. bovis and MAP respectively. The flasks were rocked every 15 minutes for two hours and the at six hours post infection medium removed, cells washed in RPMI 1630 medium, and complete medium added. At an MOI of 10:1 uptake of MAP achieved 40–60% of cells infected.

At selected time points RNA was extracted. Medium was removed and the cells were washed with PBS then 2.5 Ml Tri Reagent (Sigma) was added and left for 20 minutes to ensure maximum mycobacterial lysis and inactivation. RNA was extracted as recommended by the manufacturer and the concentration and quality of total RNA was assessed using a Nanodrop Spectrophotometer and Agilent Bioanalyzer 2100. The methodology developed provides a model system for examining macrophage behaviour in vitro.

In the MacroSys project this model has been used to explore the impact of mycobacterium infection on macrophage gene expression and gene knock down on mycobacterium survival, however the system can also be used to investigate response to infection with other pathogens or external stimuli.

2) Application of the in vitro model to study the effects of in vitro mycobacterium infection on gene expression in monocyte derived macrophages

Rationale

Macrophages change their phenotype and function in response to a wide range of stimuli, and thus their transcriptome may change radically over time in response to infection status. Gene expression profiling has been used to interrogate the host-pathogen dialogue to identify key genes involved in host pathogenesis and immunity, as well as disease resistance. There are now extensive genomic resources available for cattle to develop the tools for investigating gene expression. There are over one million bovine ESTs in the public databases for cattle, and an annotated draft sequence is available. Thus using transcriptome sequencing (RNA-Seq) expression profile of macrophage can be explored and even subtle changes in the expression of genes associated with infection with different species and strain of mycobacterium can be detected and interpreted using knowledge of metabolic pathways.

Experimental protocol

Monocyte derived macrophages were infected with M bovis strains AF2122/97 and G18 and MAP strains C and L1 and RNA prepared at 2, 6, 24 and 48 hours post infection and in addition from medium-only controls. RNA samples were reverse transcription then, Illumina TruSeq adapters with indexes were ligated to the ends of the cDNA fragments using TruSeq RNA-seq sample prep kit (Illumina, Inc., CA, USA). The libraries were sequenced as multiplexes, four tagged samples per flow cell lane on an Illumina Genome Analyser II platform or 12 samples per lane of an Illumina HiSeq 2000. Paired-end 100 nucleotides sequences were produced from each mRNA fragment. QC analysis of the data revealed that over 95% sequences had good quality scores and on average six million reads were generated per sample. On average 80% sequences mapped uniquely to the bovine genome.

After QC the data were aligned to the bovine genome (UMD 3.1) from Ensemble release 63 using the TopHat aligner and gene counts were generated for each sample. The differential expression analysis have been performed using the CuffDiff utility from Cufflinks and finally, expression data were explored and analyzed using R with Bioconductor and the CummeRbund package. EdgeR was then used to model the data across conditions accounting for the biological pairing between control and challenged samples from the same cow. A likelihood ratio test was used to assess model fit and where the inclusion of the challenge effect significantly improved the model fit the gene was called as regulated. The false discovery rate (FDR) for differentially regulated genes was set at 1%.

Gene Expression changes

Of the 25,671 genes in the bovine genome in Ensembl release 63, about 13,000 were not detected in samples from monocyte derived macrophages, suggesting that approximately half of the genes annotated in the bovine genome are actively transcribed in these cells. Infection with M. bovis AF2122/97 resulted in a greater number of differentially expressed genes overall in comparison with controls than the G18 M Bovis strain, or either of the MAP strains. For all infections and time points more genes were up-regulated than down-regulated, the latter accounted for between 8-39% of regulated genes.

At two hours post infection the greatest response to M. bovis strain G18 with 365 genes differentially expressed, and the weakest response was induced by MAP strain C with 195 genes differentially expressed. There was a common response to all four Mycobacterial strains for 138 genes. For these common genes, the two M. bovis strains induced a significantly greater change in gene expression than the MAP strains. Only five of the common response genes were down-regulated

At six hours post infection the greatest transcriptional response was observed was to M Bovis strain AF2122 with 1222 genes differentially expressed, and the weakest response was to MAP strain C where 328 differentially expressed genes were detected. There was overlap in the response to the Mycobacterial strains, with 274 co-regulated genes, of which 64 were down-regulated. In addition to protein-coding genes the microRNA miR-147, was identified as a common response gene.

By 24 and 48 hours the transcription response was much weaker than observed at the earlier time points. The greatest late response was observed at 48 hours post M. bovis AF2122/97 infection with 327 differentially expressed genes and the weakest for MAP strain C infection with 97 differentially expressed genes. The overlap in differentially expressed genes to the four Mycobacterial strains was only 38 and 39 genes at 24 and 48 hours respectively. Between M. bovis strains there was more overlap than between species of mycobacterium. GO terms associated with Chemotaxis, Regulation of Cell Activation and Cell Cycle were over-represented in the M. bovis common response, whilst Lipid Homeostasis was over-represented in the MAP common response

Interpretation

Across early time points and infections differentially expressed genes fell into GO categories which included the response to stimulus, response to stress, inflammatory, immune system and defence responses, demonstrating that the macrophage mounts a significant response to the presence of Mycobacteria. Responses could broadly be separated into an early response from 2-6 hours post infection, which involved genes with GO terms associated with Cytokine and Chemokine Signalling, NFκB Cascade, Jak-STAT Signalling and Toll-like Receptor Signalling, and a late responses from 24-48 hours post infection which involved genes associated with Antigen Processing and Presentation, and the Phagosome.

For all four mycobacterial pathogens and at both early and late time points, only fourteen common response genes were identified. These included several acute phase proteins, including serum amyloid A2, and haptoglobin also CCL5, SAA3, SOD2 and TNFAIP3. Over 420 genes were differentially expressed in response to the two M. bovis strains were not significantly affected by MAP infection. Many of these genes were associated GO terms involving Amino Acid Transport and Regulation of Cell Differentiation. If this data holds true for in vivo infection, such genes could be used to discriminate M.bovis from MAP infections

The transcriptome responses to mycobacterial infection observed in vitro could potentially form the basis of a diagnostic assay, if they are maintained in vivo and if they are shown to be mycobacterial infection specific. However, the rapid decline in differentially expressed genes from 6-48 hours post infection makes the window of detecting infection using differential expression in macrophages very brief.

3) Optimisation of a gene knock-down system

Context

The macrophage represents an attractive experimental system with which to the investigation host-pathogen interactions, the role of cytokines and other immune regulatory factors. The manipulation of gene expression in macrophages would provide a means to study the role of the macrophage in the development of host pathogenesis and defence. The direct introduction of DNA into macrophages is difficult, partly because they are non-dividing cells, and partly because no characterised cow macrophage cell lines are available. Therefore work has to be carried out on freshly prepared cells that have a limited life span. Using such cells requires transfection systems that have high efficiency and cause the minimum perturbation to macrophage functions, specifically gene expression. Gene-knockdown by RNA-interference has emerged as a powerful tool in the armoury of the molecular geneticist, and various methods are available to introduce the interfering RNA into cells. The development of viral vectors that can efficiently transduce short hairpin RNA (shRNA) into cells grown in culture represents a significant step forward. Specifically, lentiviral vectors have been used successfully to transduce human primary macrophages. Electroporation has the advantage of not using exogenous agents that may have a lasting effect on cell function, whereas the use of agents the fuse with the cell membrane may provide a gentler mechanism for introducing exogenous DNA into cells. Lipofectamine reagents are cationic lipid subunits which form liposomes in aqueous conditions. The positively charged liposomes form complexes with nucleotides (DNA or RNA) and interact with the negatively charged cell membrane, which results in the liposome: nucleotide complex entering cells by endocytosis.

SiRNA are small oligo-nucleotide sequences designed to be complementary to specific mRNA transcripts. Once bound to their target mRNA, the RNAi-mRNA hybrid is incorporated into the RNA interference complex resulting in the degradation of that mRNA, which leads to target gene knockdown. SiRNA are simpler to design and easier to introduce into cells than more complex gene knock-down molecules, however the duration of target gene knock-down is short and may not be adequate to affect M. bovis infection. In this case siRNA may be used, the effects of which have a longer duration. Interfering RNA sequences that effectively knock down target gene expression can be designed using on-line search programmes that are freely available, e.g. Dharmacon.

Method comparison and Established Protocol

Electroporation and transfection were tested for siRNA uptake by primary bovine monocyte-derived macrophages. Transfection reagents tend to induced an interferon response which was specifically investigated. Three transfection reagents were tested, Lipofectamine RNAiMAX and DharmaFECT 3 which were compared with eletroporation. RNAiMAX did not induce significant interferon response, but had greater target gene knock-down with lower cell toxicity than electroporation. RNAiMAX is a lipofectamine specifically designed to promote uptake of small interfering RNA (siRNA). Using this transfection reagent allows siRNA to be reapplied to cells in culture and hence extend the period of target gene knockdown.

Monocyte derived macrophages, prepared as described above, are plated at density of 3-6 X105 cells in 25ml plates and incubated overnight to recover. RNAiMAX is added to an aliquot of serum free Opit-MEM medium, and the selected Si-RNA added to a second aliquot of Opti-MEM, the two solutions are then combined and gently mixed for 20 minutes at room temperature. Medium is then removed from the macrophages and the RNAiMax-siRNA mix added to the plates which are swirled to mix. Cells are incubated for 24 hours to allow uptake of the siRNA, then washed. At this point effects of the siRNA on target and control gene can be observed through a time course following transfection, or cells infected with pathogen.

Verification of gene knockdown

Both electroporation and transfection with RNAiMAX achieve gene knock down of the three test genes: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH); v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) (c-MAF); and Mediterranean fever (MEFV). Expression knock-down of typically 60% which persisted for between 72-96 hours following introduction of the siRNA, depending on the construct used.

The expression knock down protocols provide a way to test the effects of specific genes on macrophage function and responses. While used in the MacroSys project to investigate the impact of candidate genes on mycobacterium survival, the approach has wider application to investigate the interaction of the macrophage with other pathogens or to external stimulii.

4) Impact of candidate gene knock-down in macrophage on mycobacterium survival

The role of candidate genes on macrophage function and the response of macrophage in vitro to mycobacterium infection can be tested by using the macrophage infection model system along with the gene expression knock down protocols developed by the MacroSys project. Information obtained from these studies will provide evidence for the relevance of genes with observed with differential expression following infection. The interaction between gene expression and mycobacterium replication and viability may also provide information pharmaceutical treatments that may control infections.

By using transient transfection and electroporation as routes of siRNA delivery, expression of six target genes was knocked down in bovine macrophages. These genes were: the house-keeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH); plus 5 candidate genes with effect on mycobacterium: the transcription factor v-maf musculoaponeurotic fibrosarcoma oncogene homolog (c-MAF), knock-down of which has been shown to inhibit Mycobacterium tuberculosis growth in human macrophages; the Mediterranean fever gene (MEFV), an important regulator of inflammation which MacroSys data have shown to be up-regulated in response to M. bovis and MAP infection; the anti-inflammatory genes interleukin 10 (IL10); the suppressor of cytokine signalling (SOCS) 3, and the anti-inflammatory microRNA miR-147, all of which MacroSys indentified as being up-regulated in macrophages in response to infection with both Mycobacteria species. siRNA were designed and tested for the five candidate genes and their effectiveness at knocking down target gene expression was confirmed by qRT-PCR.

The knock-down of MEFV expression in bovine macrophages was found to reduce release of active IL1β in response to lipopolysaccharide stimulation. The function of bovine MEFV is unknown however the reduced production of IL1β is consistent with the propsed function of human MEFV, which has been shown to regulate inflammasomes: protein complexes that control the release of IL1β and IL18.

The effect of knock down of the candidate genes on mycobacterium uptake and survival in primary bovine monocyte-derived macrophages was tested by infection of macrophages, following gene knockdown, with Bacillus Calmette-Guérin (BCG), an attenuated strain of Mycobacterium bovis. Using fluorescently labelled-BCG no immediate effect was observed by knocking down any of the 5 the target genes. However, IL10 siRNA-treated monocyte derived macrophages consistently contained fewer BCG genome copies than other siRNA-treated MDMs and controls, suggesting that the reduced IL10 inhibits BCG growth and it is required by BCG for replication. Unexpectedly, IL10 siRNA was also associated with an increase in bovine genome copy number suggesting that that BCG induces bovine proliferation in the absence of IL10.

Variable results were obtained with the siRNA targeting other genes. In particular, c-MAF siRNA frequently induced MDMs cell death.

The candidate gene knockdown studies identified IL10 to be important for BCG replication. RNASeq analysis of in vitro infected macrophages showed that IL-10 was up-regulated at early time points following both M bovis and MAP infection, therefore it is unclear if regulation of this gene is a cellular response to control the infection, or expression of this gene is stimulated by the mycobacterium to promote replication. However, the role of IL10 in controlling BCG response has also been observed in mice. Therefore these results suggest that manipulating IL10 expression may be an approach to control disease progression in vivo.

Assessing mycobacterium viability

Mycobateria grow very slowly in culture and colonies only become visible on agar plates after several weeks. Therefore assaying for viability using classical culture approaches of the slow growing organisms takes several weeks. Therefore alternative approaches to assess replication and viability are required. Two approaches were developed by MacroSys one assaying the ratio of host vs mycobacterium genome which revealed whether the mycobacterium had replicated and the second assayed the viability of the invading bacteria.

For the first approach infected macrophage harvested and with PBS to remove extracelluar BCG. Genomic DNA was immediately extracted from the cells using the Wizard DNA extraction kit (Promega) and used to quantify the number of BCG and bovine genome copies in the sample by qPCR using the Brilliant III Sybr Green kit (Agilent).

The BCG genome copy number was quantified by the amplification and detection of the single copy gene 85B antigen gene (MY85B) using primers

KJ643 5’-CATCAAGGTTCAGTTCCAGAGC-3’
KJ644 5’-TATCCCAGCCGTTGTAGTCG-3’

The bovine genome copy number was quantified by the amplification of the single copy Spastin gene using previously reported primers:

PL_CTRL-F-36 5’-CAACACCTGCGTCCCTTT-3’
PL_CTRL-R-36 5’-CGCAGGGCAGATCAGTTT-3’

The second approach assessed the viability of both mycobacterium within the macrophage by quantifying the number of DNA copies of the16S ribosomal gene present, then comparing this with the RNA present for this gene. The number of viable vs total number of MAP (viable and dead) can then be calculated from the ratio of 16S RNA:DNA. Protocols for preparing RNA and DNA from the same samples and Ribosomal 16S promers were as described by Bull et al Gut Pathogens 2009, 1:25 doi:10.1186/1757-4749-1-25

PCR primers use for the amplification of 16S RNA were:

pre16SrRNA.R GCGCAGCGAGGTGAATTT
pre16SrRNA.F TTTGGCCATACCTAGCACTCC

These two approaches used together provide a way to monitor infection of mycobacterium and how the organisms respond to changing environments, whether as a result of changes in gene expression as described here, or to assay the effects of external stimuli or trials of potential pharmaceutical agents

5) Genome-wide Association Studies for MAP susceptibility

Genetics of susceptibility

A substantial influence of genetic variation has been shown for TB susceptibility in red deer with an estimated heritability of 0.48. In dairy cattle daughters within specific sire families show correlated response to TB infection. Therefore there is evidence that TB susceptibility is genetically influenced. There is an influence of cattle breed on the occurrence of paratuberculosis while analysis of disease occurrence in sire families provides an estimate of heritability of 0.10. Thus there is also evidence of a genetic component to Johnes disease susceptibility. Identifying genetic variations associated with susceptibility would highlight cellular mechanisms involved in response to these diseases and if sufficiently strong, information on genetic loci involved could be incorporated into breeding programmes.

Data and samples for Genome Wide Association Studies (GWAS)

The international bovine genome project provided a wealth of information on the organisation of the bovine genome and has identified many millions of single nucleotide polymorphisms (SNPs). There have been rapid advances in SNP genotyping technologies that have made it possible to genotype thousands of SNPs simultaneously. Using high density marker panels localising the loci controlling traits can be achieved by association mapping approaches to refine QTL to small confidence intervals. The most widely used SNP assay is the 50K bovine SNP Bead Chip from Illumina, which has been used as the basis to develop genomic selection strategies that are now widely adopted in dairy cattle breeding. Using this 50K panel the DGAT1 gene, in which a polymorphism is known to be associated with fat synthesis, was located within a 3000bp region with a LOD score of 150. Using this SNP panel is appropriate to localise the genetic loci with a strong influence on susceptibility to mycobacterial infection. However, to carry out a genome wise association study (GWAS) of this type it is essential to have relatively large numbers of individuals in which a defined phenotype characterising the susceptibility to infection is measured

Diagnosis of MAP infection in the pre-clinical stage in cattle is difficult, largely because of the prolonged incubation period and slow progression of the disease in the animal. The culture of the organism from faeces is considered to be the most sensitive and highly specific test available for the diagnosis of Map infection in the live animal, but in the early stages of infection there are few, if any, organisms shed in the faeces. Even for clinical cases a surprisingly low level of detection (70%) is achieved. In addition, if animals ingest large numbers of MAP bacteria from a heavily contaminated environment it is possible for them to pass through the gut without replication within the host and give a false positive on faecal culture. Although there is little or no detectable humoral immune response during early phases of disease, serological tests are attractive for the mass screening of cattle for paratuberculosis. Antibody production occurs relatively late in the progression of the disease and some animals that show clinical disease fail to produce antibody at all. However, the absorbed ELISA is now widely accepted as the standard serological test for paratuberculosis in cattle and a sensitivity of the test is over 85% for animals identified as clinically affected. The ELISA assay from IDVet is commonly used for screening and eradication programmes for Johnes disease, thus providing a databank and abundance of test samples. Therefore the MacroSys used ELISA data and samples for a GWAS of Johnes disease

GWAS of antibody response to Johnes Disease

Case and control samples were selected from field samples collected in 2007 and 2008 in the Lodi province of Lombardy in Italy. Cases were defined as animals serologically positive for MAP by Elisa and controls were negative to the ELISA that were from the same farms and of the same age and sex as cases. Samples were selected randomly among those collected from 119 farms in which Johnes disease was present. A total of 966 samples, 483 were MAP antibody positive (cases) and 483 MAP antibody negative (controls), were genotyped using the Illumina BovineSNP50 BeadChip which contains 54001 SNPs with an average probe spacing of 51.5kb and a median spacing of 37.3kb based on the BTAU4.0 (University of Maryland). Following quality checks of genotype data for each SNP and sample, the final data set that passed the quality controls and was used in the association analysis contained 46350 Genome wide SNPs and 925 samples.

Genome-wide association analysis was performed using the GenABEL package in R (Aulchenko et al. 2007) using a three step GRAMMAR-CG approach, (Genome wide Association using Mixed Model and Regression - Genomic Control), with the extension of using the genomic kinship matrix estimated through genomic marker data, instead of the recorded pedigree

The Genome Wide Analysis identified SNP with significant associations on chromosomes 12, 8, 9, 11, and 27. The most convincing association was on chromosome 12 were Three moderately significant SNPs were identified at positions 69663832, 69599639 and 68553182 with p-values of 1.04e-06 1.44 e-06 and 1.50e-05 which explained 0.48 % 0.46% and 0.38% of the variance respectively. In addition 2 further SNP on chromosome 12 in position 67342543 and 69808111 were close to significance. Two of the significant SNP are located in introns of coding region of the genes IPI00841680.2 and IPI00824465.3. Chromosome 9 and 11 has two moderately significant SNP in position 46362363 and 89695126 explaining 0.34 and 0.33 of the variance respectively. One SNP on chromosome 8 in positions 37257076 was close to significance as was one on chromosome 27 in position 45253563.

Confirmation studies

The 6 SNP with highest p-values were tested using the same test statistics and by simple regression on a smaller cohort of 277 cases and control Holstein animals drawn from the same population used for the main GWAS. Case were randomly chosen and controls were selected to be herd, test day, sex matched. Following correction for multiple testing (n=6), five of the six SNPs tested showed significant association in the smaller cohort. These were the two most significant SNP on BTA 12, and the SNP on 9 and 11. The 6 SNP most significant from the initial study were also analyzed in 26 limousine cows (13 cases and 13 controls). None of the SNPs showed significant association prior to or after correction for multiple testing.

Fine mapping

The 3 genomic regions with highest statistical support in the initial GWAS, on chromosomes 8, 9 and 12, were analysed in more detail by the addition of new markers within the QTL regions. SNP markers were selected from the validated markers of the high density Illumina SNP panel that fell within 2MB of the significant SNP. A custom fine mapping genotyping panel was created for the Illumina Bead Express to genotype 384 markers. A cohort 1440 animals was selected, 920 positive samples and 920 negative samples for the ELISA test. All animals were genotyped and association analysis was carried out using the GRAMMAR method and a logistic regression analysis taking into account the linkage between markers. Evidence for QTL was confirmed for Chromosomes 12 and 9. SNP on Chromosome 12 showed 2 well defined QTL regions, Chromosome 9 had one main QTL at 44.5 Mb while Chromosome 8 shows less evidence of real QTL region.

Meta-analysis with other Johnes associated phenotypes

For the study of livestock diseases the use of field samples is indispensable, however, there are many complex host-environment interactions which affect the presentation of diseases and their level of incidence. The definition of an infected animal can be based either on the presence of anti-MAP antibodies in the serum, as was chosen for the Macrosys study, or bacterial culture from tissue or faeces as has been used in other studies. Genome wide association studies rarely stands on their own and should be considered as part of a process that accumulates evidence of association. By merging data on genetics effects for both immune response and bacterial culture, common loci may emerge and thus indicate those that are most robustly associated with disease susceptibility of resistance.

A meta analysis was carried out using data from MacroSys and data from a study carried out by the University of Washington that used mycobacterial culture as the phenotype. Thus the MacroSys data from the 483 were MAP ELISA antibody positive and 483 MAP antibody negative Holstein were merged with data from two hundred forty-five US Holstein cows that were followed to culling and assessed for the presence of MAP in culture from both faecal and necropsy tissue samples post mortem. In the US study 224 samples out of 245 were used, 107 animals were classified as tissue positive for the presence of MAP and 117 were classified as tissue negative. Both sample sets were genotyped with a SNP panels in which 54,001 SNP were in common for 1190 animals. Following quality control the data set was composed of 1153 samples and 48001 genome-wide SNP.

Analysis the data two independent studies of Johne’s disease, was carried treating the phenotype of cases and controls in two ways. In the first approach controls were animals that were ELISA or tissue culture negative, and cases were animals positive for the MAP ELISA test or were MAP positive by culture of the ileum, ileo-caecal valve or ileo-caecal lymph nodes. This analysis identified 6 moderately significant SNP associated with MAP ELISA positive or MAP tissue infection positive samples, compared to controls that were either MAP ELISA or MAP tissue negative. These SNP were two on chromosome 12 at positions 69,663,832 and 69,599,639, one on chromosome 15 at position 66,161,046, two on chromosome 1 at position 113,617,698 and 113,855,358 and one unassigned SNP. The second analysis considered controls as animals that were MAP tissue culture negative and cases animals that were either MAP ELISA positive or MAP tissue positive. This analysis identified ten loci associated with MAP status. Significant loci were: one on chromosome 22 at position 56,087,082, one on chromosome 6, one on chromosome 1 defined by 2 SNPs at positions 3,083,368 and 3,083,498. In addition 7 loci had moderate evidence of and association with disease status on chromosomes 13, 16, 21, 23 25, 13, 16, 21 and 25 (at positions respectively of 40,664,184 65977384, 72179197, 3313513, 34108529, 29929537) and one unassigned SNP.

Strongest QTL region

The chromosome 12 region was the most significant identified in the first MacroSys GWAS, was reconfirmed in the smaller study using the smaller sample set and in the fine mapping study with increased marker density and finally was identified in the meta-analysis. The QTL region is defined by 3 SNP with similar levels of significance and effect size. Several candidate genes that may have an effect on Johnes disease were identified by bioinformatic analysis within 1Mb of all the three markers on chromosome 12. Two of the significant SNPs are located within coding regions of two genes that encode the ATP-binding cassette protein (ABCC4) which is a multi-drug resistance associated protein for which polymorphisms have been shown to be involved in Crohn’s disease in man.

Genetic markers can be used for marker assisted selection in breeding programmes and potentially increase the rate of genetic progress in selection for target traits. Thus the genetic loci identified here could be used to select for increased resistance to mycobacterial diseases. However, it must be remembered that even the chromosome 12 region has the best evidence to support it, in all the studies carried out in MacroSys, it still only explains less than 1% of the genetic variation in the Holstein population. Thus if this locus were to be selected to fixation for the favourable allele, it would only make a small contribute to increased disease resistance.

Potential Impact:

The two diseases caused by mycobacterium studies in the MacroSys project, bovine tuberculosis caused by M Bovis and Johnes disease, or para-tuberculosis caused by M avium subsp. Paratuberculosis have severe impacts on agricultural production, animal health and potentially human health. Animals infected with these mycobacteria have lower levels of production, following a long incubation period can be come clinically affected, and in the case of M bovis, the bacterium can be transmitted to humans and cause tuberculosis. While Johne’s disease has not been proven to be a zoonotic agent, MAP has been, linked with Crohns disease in man. The MacroSys project results therefore have the potential to impact as several levels: the underpinning of sustainable agricultural production, animal welfare, and the quality of human life

The future success and sustainability of the European agricultural industry requires that the highest standards in animal welfare and disease control are applied. This not only increases productivity, but also consumer confidence in agricultural products. MacroSys was forward thinking at it’s inception by working towards genomics orientated solutions to address mycobacterial infections. The project outputs contribute knowledge for the development of improved disease surveillance tools and also to the potential genetic selection of animals which are less likely to be infected and carry theses disease.

Economic impact.

The future economic benefits that may accrue from the application of MacroSys findings will impact on the efficiency of disease control. Identification of a TB case, which is notifiable, results in the implementation of costly test and slaughter programmes and trade restrictions. Bovine TB is a barrier to free trade that is estimated to cost ~3 billion $ per annum worldwide. Reducing disease frequency for Johnes disease, which is not notifiable and hence not strictly controlled, will result in increased milk yields. MAP results in lower productivity increased veterinary care and early culling, hence increased replacement of animals, with a cost, as a very conservative estimate, of €250M per annum in lost productivity in cattle in the EU, with lower, but significant losses in other farmed species (EC report “Possible links between Crohn’s disease and Paratuberculosis SANCO/B3/R16/2000). Reducing Johnes disease would improve consumer confidence in the farm products of EU in the face of global competition and imports.

Reduced disease burden will contribute to the development of the rural communities in EU through increased productivity and efficiency, supporting sustainable development. While In developing countries disease has significant economic and health consequences for cattle keepers and their communities, including loss of animal productivity and reproductive success, diminished market opportunities and poor work capacity for farming and transport.

Environment.

Mycobacteria are able to survive outside the animal for extended periods of time in the environment including in river water, pond water, bovine faeces and soil. The organism is resistant to many disinfectants and so contamination from infected animals is difficult to control. Bacteria shed by infected animals are directly transferred to pen mates. However, with such robust organisms the inevitable escape of the bacteria into the environment has the potential for transmission to other farms on vehicles and clothing, to human food processing plants or to wildlife populations.

The results from MacroSys will contribute knowledge to reduce overall disease incidence, which will have a positive effect in reducing the environmental burden of mycobacteria. This will give rapid benefits by increasing productivity, but will have lasting effects by avoiding the diffusion of the organism into the environment.

Animal welfare.

Following of a single case of TB control measures in the EU require culling of cohort animals. Many wild species are hosts for M. bovis therefore infection in domestic species may pass to wildlife populations, which then become a reservoir and potential source of infection. In some areas wildlife culling has been instigated to reduce this threat, most notably the badger cull in Southern England.

For Johnes disease the long incubation period and high turn over of cattle, particularly in dairy herds, means the disease can remain hidden as few clinical cases are observed. It has been suggested that for every clinical case there may be a further 25 infected animals incubating the disease. In addition to the impact on productivity, the clinical phase of the disease is unpleasant for affected individual and characterised by a gradual loss of condition, as the disease progresses animal loose condition and weight and eventually die.

Improvements in animal health and welfare combined with reduction in the zoonotic risk of disease transmission will contribute to improved productivity, and lower overall management.

Quality of Life.

Tuberculosis (TB) and Para-TB are caused by Mycobacteria which are pathogenic or opportunistic slow-growing mycobacteria http://www.oie.int/eng/publicat/rt/2001/A_R2010.htm(odnośnik otworzy się w nowym oknie). This class of bacteria differs widely in terms of their host tropisms, phenotypes and pathogenicity. Human tuberculosis caused by M. bovis is clinically indistinguishable from tuberculosis caused by M. tuberculosis and as a result, there is substantial underreporting of tuberculosis cases caused by zoonotic transmission of M. bovis in regions that lack basic medical infrastructure. Over one-third of the world's population is affected by tuberculosis and new infections occur at a rate of one per second (W.H.O. 2006). Only a small proportion of infected individuals progress to clinical disease and asymptomatic latent TB infection is common. However, one in ten latently infected individuals will progress to clinical TB disease, which if left untreated, is fatal in more than half of all cases. In 2004, 14.6 million people had clinical TB and 8.9 million new cases were recorded, with 1.7 million deaths mostly in developing countries (W.H.O. 2006). Bovine TB is a barrier to free trade and is estimated to cost ~3 billion $ per annum worldwide.

The hypothesis that MAP could be the etiologic agent causing Crohn’s Disease, an inflammatory bowel disease, was proposed may years following the recovery of mycobacterium from the gut of a few Crohn’s Disease patients, indeed MAP can be recovered from about 30% of Crohn’s patients. These isolates have been shown to be pathogenic in laboratory animals and in one study produced granulomatous disease of the distal intestine of goats. However, finding MAP in the gut of healthy patients and even cultures from breast milk of lactating mothers, makes the association between MAP and inflammatory bowl disease and Crohns disease, at best, tentative. The disease can, therefore be more properly considered as a health problem in livestock.

Role of MacroSys.

The findings of the MacroSys project in vitro infection studies could contribute to the developed of diagnostic management tools based on changed in gene expression, which could be used to improved disease surveillance and disease eradication programmes on farm. The genetic association data has the potential for incorporation into genetic selection programmes for cattle to breed individuals with increased genetic resistance, specifically to mycobacterial infections and possibly to a wider range of pathogenic intracellular bacteria. Hence the project will impact directly on improved animal health. Healthy livestock are more productive and so the improvements achieved will contribute to improved efficiency and profitability of animal production and competitiveness of animal production and hence the sustainability of farming systems. In reducing the frequency of mycobacterial infections, some of which are proven to be zoonosis, others are potential zoonosis will improved safety on the farm for animal workers and reduce risks from animal products and hence safeguard human health.

Dissemination and exploitation of project results

The MACROSYS dissemination strategy aimed at targeting both internal partners and external public, in terms of general public and the scientific community, in order to build a detailed awareness on the topic addressed by the Project and the planned activities and results achieved.

Internal dissemination. Internal meetings: several internal meetings, both physical and virtual, have been organized during the entire length of the Project, to improve the collaboration between the partners and strengthen the Consortium; Project management section of the website: the private section of the Project website, has been set up and implemented to circulate the working documents, discuss on potential issues and get a constant update on the undergoing activities. The access to the project management area is protected by password and granted only to the MACROSYS parnters.

External dissemination. Public section of the website: the MACROSYS Project website presents general information on the Project, such as its objectives, the partners involved and the organization in Work Packages; International workshops and conferences: the partners involved in the MACROSYS Project are active members of the international scientific community, therefore they have taken part to workshops and conferences to disseminate the Project itself and the results they have achieved within it. Publications: the MACROSYS Project results have been or are going to be published in peer reviewed journals of interest to the specific areas of research investigated.

Internal Meetings

In order to ensure a proper internal collaboration and cooperation among the partners involved in the MACROSYS Project, internal meetings and conference calls have been organized during the entire Project duration.

During the first reporting period (01/11/2008 – 30/04/2010) the following face-to-face meetings were organised: Kick off meeting, Lodi (Italy), 19-20/01/2009; 2nd Project Meeting, Dublin (Ireland), technical and administrative meeting, 10-11/09/2009; 3rd Project Meeting, Roslin Institute (Edinburgh, U.K.): this meeting had to be cancelled as a result of air travel disruption caused by volcanic ash. The physical meeting was hence held as a virtual conference call. The following planned face-to-face meeting took place in July 2010, at the beginning of the second reporting period. In addition to the physical meetings 5 virtual conference calls were organised by the PAT on the following dates: 29/07/2009, 30/10/2009, 03/12/2009, 18/02/2010, 22/04/2010 (in place of the face-to-face meeting initially planned to be held at Roslin Institute, Edinburgh, U.K.).

During the second reporting period (01/05/2010 – 30/04/2011) the following face-to-face meetings took place: 3rd Project Meeting, Roslin Institute (Edinburgh, U.K.) technical and administrative meeting, 14-15/07/2010; 4th Project Meeting, Belfast (U.K.) technical and administrative meeting, 07-08/04/2011. The following conference call was organised by the PAT: Macrosys Virtual Meeting, 14/10/2010.

During the third reporting period (01/05/2011 – 31/10/2012) the following face-to-face meetings were organised: “RNASeq Data Analysis Meeting”, Edinburgh (U.K.) 30-31/05/2011; 5th Project Meeting, Giessen (Germany), technical and administrative meeting, 14-15/02/2012; 6th Project Meeting, in Brussels (Belgium), technical and administrative meeting, 10/09/2012. In order to effectively coordinate the collaboration among partners 6 virtual meetings were organized during the third reporting period: 02/10/2011, 02/05/2012, 16/05/2012, 06/06/2012, 20/06/2012.

During the fourth reporting period (01/11/2012 – 30/04/2013), the following meeting took place: Final Macrosys Meeting, Brussels (Belgium), technical and administrative meeting, 16/04/2013. The following virtual conference call was organized: MacroSys Virtual Meeting, 06/12/2012.

The minutes of all the internal meetings organized during the entire length of the MACROSYS Project have been inserted as Annexes to the corresponding Periodic Reports (First, Second, Third and Fourth) submitted to the EC.

Public website

In order to get in contact with the scientific community and with the general public, a public website is the ideal tool to be used. As a consequence, soon after the project starting date a project website has been designed to ensure a proper external communication.

A dedicated MACROSYS website has been set up and regularly updated (http://www.macrosys-project.eu(odnośnik otworzy się w nowym oknie)) in order to provide a vision on the project, by presenting the project objectives and activities to the public.

The MACROSYS website consists of a public outreach section including the home page that provides an overview of the project and the scientific partners, structured as follows: Home page, introducing the MACROSYS Project, its logo and relevant information such as the project coordinator and the FP7 call on which it is funded; Overview, containing a brief summary of the project, its area of interest and the scientific framework; Partners, presenting the project partners, their logos and links to their official websites; Objectives, exploring the problems tackled by the Project, its general objectives and the phases in which it is articulated; Work packages, presenting a summary on each of the Work Packages in which the Project is divided, from WP1 on “Literature review and compilation of in silico data” to WP8,on “Development of diagnostic and selection tools”; Project outputs, showing public resources developed within the MACROSYS Project.

Project Management section of the website

In addition to the public area, a specific secure and private project management section has been set up and implemented, in order to ease and facilitate the internal collaboration and communication between partners.

The collaborative area of the MACROSYS website can be reached from the navigation menu of the public website, or directly through the following URL: http://www.macrosys-project.eu/management/login(odnośnik otworzy się w nowym oknie).

The project management section includes the following features: project activity monitoring system, where activities in the project can be planned and discussed; project news, for project related news; project documents, for the publication of all kinds of documents, like Deliverables, relevant literature, minutes of meetings, presentations and reporting documents; project discussion forums, with dedicated parts for the various WPs; project WIKI, description of the project subject with links to external information sites. Description of various work packages with literature sharing and other information.

Moreover, relevant literature information has been selected and stored in EndNote libraries, uploaded and shared amongst project partners using the MACROSYS project website.

The project website has been periodically updated during the Project, in order to include all the relevant information and results achieved by the partners.

Conferences

During the entire Project, MACROSYS partners, as active members of the scientific community, took place to several conferences and workshop: the Project and its results were presented and disseminated during these occasions (see Section 4.2B).

Publications

Besides the activities of the partners within the aforementioned international conferences and workshops, several articled in peer-reviewed journals have been submitted and published during the Project timeframe. Publications are a fundamental tool to certificate the results and the outcomes of the Project (see Section 4.2A).

Dissemination after the project end

Dissemination plans after the conclusion of the Project are intended to further promote the MACROSYS visibility, mainly by means of the dissemination tools created and exploited during the project timeframe.

The main channel through which the MACROSYS results and activities will continue to be promoted is the Project website, which will continue to be updated and maintained online for at least 3 years after the project conclusion.

Moreover, the Project will continue to be presented and promoted during workshop and events, as happened on May 2013, when PTP made a presentation on the MACROSYS Project during the EADGENE_S Final Event held on 14th May 2013 in Brussels (Belgium). The presentation, by Giulietta Minozzi (PTP) took place in the satellite session “Overview FP7 projects on animal health and genomics”.

Exploitation of findings

The work carried out in the project is available for exploitation at several levels. Most outputs are fundamental scientific knowledge and as such provide the foundation of further scientific investigation. The expression pattern data reveals the situation in vitro and further development to create a diagnostic test will require additional studies to determine if the observations are mycobacterium specific. Should the expression patterns prove to be sufficiently specific, additional studies would be required to define the sensitivity of a test that may be developed using this information for in vivo infection, and the period following infection when the diagnostic assay would be valid.

The project partners will develop suitable plans for the further development of project findings, eg through follow-on outreach projects through business-research partnership agreements. Exploitation of the project outputs will be in accordance with the Project Collaboration Agreement.

List of Websites:

http://www.macrosys-project.eu(odnośnik otworzy się w nowym oknie)

John Williams
Tel: +39 03714662677
Fax: +39 03714662349
E-mail: john.williams@tecnoparco.org